Incidental Mutation 'R3435:P2rx4'
ID267156
Institutional Source Beutler Lab
Gene Symbol P2rx4
Ensembl Gene ENSMUSG00000029470
Gene Namepurinergic receptor P2X, ligand-gated ion channel 4
SynonymsD5Ertd444e, P2X4
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122707544-122729738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122725070 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 202 (I202K)
Ref Sequence ENSEMBL: ENSMUSP00000118163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000081554] [ENSMUST00000139631] [ENSMUST00000142664] [ENSMUST00000198560]
Predicted Effect probably damaging
Transcript: ENSMUST00000031429
AA Change: I229K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470
AA Change: I229K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 381 3e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081554
AA Change: I202K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080269
Gene: ENSMUSG00000029470
AA Change: I202K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 1.6e-72 PFAM
Pfam:P2X_receptor 170 361 2.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132062
Predicted Effect probably damaging
Transcript: ENSMUST00000139631
AA Change: I202K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118163
Gene: ENSMUSG00000029470
AA Change: I202K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 3.7e-73 PFAM
Pfam:P2X_receptor 171 301 4.6e-59 PFAM
Pfam:P2X_receptor 299 331 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139712
Predicted Effect probably damaging
Transcript: ENSMUST00000142664
AA Change: I229K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117193
Gene: ENSMUSG00000029470
AA Change: I229K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 358 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198560
SMART Domains Protein: ENSMUSP00000142849
Gene: ENSMUSG00000029470

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 47 6.9e-9 PFAM
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in hypertension, abnormal artery morphology, abnormal nitric oxide homeostasis, and impaired flow induced vascular remodeling and vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in P2rx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0709:P2rx4 UTSW 5 122714404 missense probably damaging 1.00
R1081:P2rx4 UTSW 5 122727233 missense probably damaging 0.98
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R3434:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R5090:P2rx4 UTSW 5 122725055 missense probably damaging 1.00
R5318:P2rx4 UTSW 5 122719148 missense probably null 1.00
R5888:P2rx4 UTSW 5 122719165 missense probably benign
R5888:P2rx4 UTSW 5 122727208 missense probably damaging 1.00
R5994:P2rx4 UTSW 5 122725079 missense probably damaging 1.00
R6450:P2rx4 UTSW 5 122727241 missense possibly damaging 0.88
R6478:P2rx4 UTSW 5 122707700 missense probably damaging 0.99
R6847:P2rx4 UTSW 5 122727751 missense probably damaging 1.00
X0064:P2rx4 UTSW 5 122707779 nonsense probably null
X0066:P2rx4 UTSW 5 122707745 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGCTGCAGAAAACTTCACC -3'
(R):5'- ATACCCATGATGCCTCCCTG -3'

Sequencing Primer
(F):5'- TCCATAACGAGATCTGGTGC -3'
(R):5'- CCTGTGGGGAAAGCAGG -3'
Posted On2015-02-18