Incidental Mutation 'R3435:Tmem117'
ID267167
Institutional Source Beutler Lab
Gene Symbol Tmem117
Ensembl Gene ENSMUSG00000063296
Gene Nametransmembrane protein 117
Synonyms
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94629232-95096098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95094692 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 411 (I411T)
Ref Sequence ENSEMBL: ENSMUSP00000079038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080141] [ENSMUST00000229933]
Predicted Effect probably damaging
Transcript: ENSMUST00000080141
AA Change: I411T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079038
Gene: ENSMUSG00000063296
AA Change: I411T

DomainStartEndE-ValueType
Pfam:TMEM117 4 416 1.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189291
Predicted Effect probably benign
Transcript: ENSMUST00000229933
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Tmem117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Tmem117 APN 15 95094664 missense probably benign
IGL02342:Tmem117 APN 15 95011450 missense possibly damaging 0.76
IGL02418:Tmem117 APN 15 94931884 missense probably benign 0.10
IGL02651:Tmem117 APN 15 95094561 missense probably damaging 1.00
IGL02740:Tmem117 APN 15 94714982 missense probably benign 0.00
IGL02819:Tmem117 APN 15 94879372 splice site probably benign
IGL02881:Tmem117 APN 15 94879425 missense probably damaging 1.00
IGL02887:Tmem117 APN 15 95094775 missense probably damaging 1.00
IGL03371:Tmem117 APN 15 95011393 missense probably damaging 1.00
R0464:Tmem117 UTSW 15 94714919 missense probably damaging 0.98
R0539:Tmem117 UTSW 15 94714912 missense possibly damaging 0.63
R1029:Tmem117 UTSW 15 95011336 missense probably benign
R1424:Tmem117 UTSW 15 94931808 missense probably benign 0.35
R1439:Tmem117 UTSW 15 95094597 missense probably benign
R1498:Tmem117 UTSW 15 94638361 missense probably damaging 1.00
R1604:Tmem117 UTSW 15 95094544 missense probably damaging 1.00
R1746:Tmem117 UTSW 15 94931833 missense possibly damaging 0.55
R1829:Tmem117 UTSW 15 95094551 missense probably damaging 1.00
R3434:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R4560:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4561:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4562:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4563:Tmem117 UTSW 15 94638154 missense possibly damaging 0.95
R4777:Tmem117 UTSW 15 95094450 nonsense probably null
R4854:Tmem117 UTSW 15 95094688 missense probably damaging 0.97
R5051:Tmem117 UTSW 15 94714913 missense probably damaging 0.96
R5472:Tmem117 UTSW 15 95094513 missense possibly damaging 0.91
R5485:Tmem117 UTSW 15 95094830 missense probably benign 0.00
R5488:Tmem117 UTSW 15 95094817 frame shift probably null
R5595:Tmem117 UTSW 15 95094884 missense probably damaging 0.99
R5648:Tmem117 UTSW 15 95094772 missense possibly damaging 0.88
R5892:Tmem117 UTSW 15 94638139 missense probably damaging 0.99
R5901:Tmem117 UTSW 15 94714958 missense probably benign 0.08
R6334:Tmem117 UTSW 15 95011443 missense probably benign 0.01
R7216:Tmem117 UTSW 15 94714912 missense possibly damaging 0.91
R7266:Tmem117 UTSW 15 94931803 missense possibly damaging 0.82
R7414:Tmem117 UTSW 15 94714895 missense probably damaging 1.00
R7445:Tmem117 UTSW 15 94714918 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGACAGTATATTGGCCCAGG -3'
(R):5'- CAAGGCAGGGTCATTCAGAG -3'

Sequencing Primer
(F):5'- CCCAGGGCAGAAGATATACACAGTG -3'
(R):5'- GGTCATTCAGAGGATCTTCCACAG -3'
Posted On2015-02-18