Incidental Mutation 'R3435:Tmx3'
ID267171
Institutional Source Beutler Lab
Gene Symbol Tmx3
Ensembl Gene ENSMUSG00000024614
Gene Namethioredoxin-related transmembrane protein 3
Synonyms6430411B10Rik, A730024F05Rik, Txndc10
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location90510154-90543267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90527904 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 203 (V203E)
Ref Sequence ENSEMBL: ENSMUSP00000025515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025515]
Predicted Effect probably damaging
Transcript: ENSMUST00000025515
AA Change: V203E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025515
Gene: ENSMUSG00000024614
AA Change: V203E

DomainStartEndE-ValueType
Pfam:Thioredoxin 30 132 3.6e-26 PFAM
Pfam:Thioredoxin_6 160 341 1.6e-27 PFAM
transmembrane domain 377 399 N/A INTRINSIC
low complexity region 418 436 N/A INTRINSIC
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This gene is expressed in many tissues but has its highest expression in heart and skeletal muscle. It is expressed in the retinal neuroepithelium and lens epithelium in the developing murine eye and haploinsufficiency of this gene in humans and zebrafish is associated with microphthalmia. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Tmx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Tmx3 APN 18 90540054 missense possibly damaging 0.53
IGL01790:Tmx3 APN 18 90511334 critical splice donor site probably null
IGL01888:Tmx3 APN 18 90527921 missense probably benign 0.05
IGL02689:Tmx3 APN 18 90537116 missense possibly damaging 0.70
IGL03212:Tmx3 APN 18 90538518 missense probably damaging 0.98
R0243:Tmx3 UTSW 18 90538489 splice site probably benign
R0255:Tmx3 UTSW 18 90540006 missense probably damaging 0.96
R0981:Tmx3 UTSW 18 90537200 missense probably benign
R1528:Tmx3 UTSW 18 90537086 missense possibly damaging 0.89
R1772:Tmx3 UTSW 18 90532997 missense probably benign
R2144:Tmx3 UTSW 18 90517490 missense probably damaging 1.00
R2155:Tmx3 UTSW 18 90510381 splice site probably null
R2202:Tmx3 UTSW 18 90527913 missense probably damaging 1.00
R2444:Tmx3 UTSW 18 90540183 missense probably damaging 1.00
R2960:Tmx3 UTSW 18 90532992 missense probably damaging 0.98
R3946:Tmx3 UTSW 18 90524335 missense possibly damaging 0.78
R4427:Tmx3 UTSW 18 90523601 missense probably damaging 0.99
R4708:Tmx3 UTSW 18 90521039 critical splice donor site probably null
R5748:Tmx3 UTSW 18 90537101 missense probably benign 0.05
R5938:Tmx3 UTSW 18 90527934 missense possibly damaging 0.79
R6266:Tmx3 UTSW 18 90537210 splice site probably null
R7311:Tmx3 UTSW 18 90540071 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCCAGGGAGGTATCTGAAAACA -3'
(R):5'- CTCTACCAAATGCAACACTGG -3'

Sequencing Primer
(F):5'- GGACTTGCAAACTTTATATGCCCCAG -3'
(R):5'- ACACTGGTAGCACTTACAAAATC -3'
Posted On2015-02-18