Incidental Mutation 'R3436:Pwwp2a'
ID267196
Institutional Source Beutler Lab
Gene Symbol Pwwp2a
Ensembl Gene ENSMUSG00000044950
Gene NamePWWP domain containing 2A
Synonyms
MMRRC Submission 040654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R3436 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location43681998-43721491 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 43706188 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 452 (Q452*)
Ref Sequence ENSEMBL: ENSMUSP00000104903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061070] [ENSMUST00000094294] [ENSMUST00000109280]
Predicted Effect probably null
Transcript: ENSMUST00000061070
AA Change: Q727*
SMART Domains Protein: ENSMUSP00000054154
Gene: ENSMUSG00000044950
AA Change: Q727*

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 488 509 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 566 576 N/A INTRINSIC
low complexity region 588 598 N/A INTRINSIC
Pfam:PWWP 628 714 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094294
SMART Domains Protein: ENSMUSP00000091852
Gene: ENSMUSG00000044950

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109280
AA Change: Q452*
SMART Domains Protein: ENSMUSP00000104903
Gene: ENSMUSG00000044950
AA Change: Q452*

DomainStartEndE-ValueType
low complexity region 213 234 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Pfam:PWWP 353 438 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129229
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp T C 4: 63,149,484 E163G probably benign Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Cadps A T 14: 12,616,158 probably null Het
Ccdc146 A G 5: 21,297,005 S804P possibly damaging Het
Cdc20b T C 13: 113,078,699 I267T probably damaging Het
Cdh8 A G 8: 99,400,718 probably benign Het
Dse G T 10: 34,152,474 N873K probably benign Het
Ehd1 G T 19: 6,277,014 E14* probably null Het
F8 A G X: 75,267,424 probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Fndc1 T C 17: 7,750,357 K1559E probably damaging Het
Ighg1 T C 12: 113,329,560 E170G probably damaging Het
Kmt2b G T 7: 30,576,692 P1794Q probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1189 T A 2: 88,592,104 F100Y probably damaging Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr138 G A 17: 38,275,530 G253D probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Pkd1l2 T C 8: 117,040,739 N1271D probably benign Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Prr16 A G 18: 51,303,123 N225D probably benign Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Sort1 T A 3: 108,337,807 I325N probably damaging Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Tmprss11b A T 5: 86,667,584 Y48* probably null Het
Tpp2 T C 1: 43,940,144 I67T probably damaging Het
Trdn G A 10: 33,468,195 probably null Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Trim17 T C 11: 58,965,233 C39R probably damaging Het
Trim52 C T 14: 106,107,307 P133L possibly damaging Het
Unc13b T C 4: 43,097,028 probably benign Het
Vmn2r94 G A 17: 18,258,388 probably benign Het
Vsig4 A G X: 96,290,816 V29A probably benign Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wnk3 T A X: 151,286,304 F886I probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfp507 A T 7: 35,787,770 Y234N probably damaging Het
Other mutations in Pwwp2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Pwwp2a APN 11 43706128 missense possibly damaging 0.46
IGL02227:Pwwp2a APN 11 43705621 missense possibly damaging 0.93
IGL02653:Pwwp2a APN 11 43706035 missense possibly damaging 0.69
IGL03258:Pwwp2a APN 11 43704565 missense probably benign 0.21
R0376:Pwwp2a UTSW 11 43704672 missense probably benign 0.00
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R2127:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2128:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2173:Pwwp2a UTSW 11 43682486 missense probably benign 0.01
R3077:Pwwp2a UTSW 11 43705385 missense probably damaging 1.00
R3437:Pwwp2a UTSW 11 43706188 nonsense probably null
R4427:Pwwp2a UTSW 11 43682517 missense possibly damaging 0.52
R5597:Pwwp2a UTSW 11 43682595 missense probably benign 0.34
R5672:Pwwp2a UTSW 11 43706141 missense probably damaging 1.00
R6132:Pwwp2a UTSW 11 43705628 missense probably damaging 1.00
R6197:Pwwp2a UTSW 11 43704596 missense probably benign 0.00
R6563:Pwwp2a UTSW 11 43705765 missense possibly damaging 0.88
R6709:Pwwp2a UTSW 11 43704727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGCATCTCCAACCACATC -3'
(R):5'- CAAATGGCAATTAACAGTCCCTG -3'

Sequencing Primer
(F):5'- GCATCTCCAACCACATCTTCCC -3'
(R):5'- ACAGTCCCTGCAAAAATTGTTTC -3'
Posted On2015-02-18