Incidental Mutation 'R3437:Pter'
List |< first << previous [record 29 of 44] next >> last >|
ID267219
Institutional Source Beutler Lab
Gene Symbol Pter
Ensembl Gene ENSMUSG00000026730
Gene Namephosphotriesterase related
SynonymsMpr56-1
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location12924041-13003455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13000994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 326 (L326H)
Ref Sequence ENSEMBL: ENSMUSP00000117009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028063] [ENSMUST00000061545] [ENSMUST00000114796] [ENSMUST00000134794] [ENSMUST00000154269]
Predicted Effect probably benign
Transcript: ENSMUST00000028063
SMART Domains Protein: ENSMUSP00000028063
Gene: ENSMUSG00000026730

DomainStartEndE-ValueType
Pfam:PTE 15 260 1.8e-105 PFAM
Pfam:TatD_DNase 66 252 3.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061545
SMART Domains Protein: ENSMUSP00000056188
Gene: ENSMUSG00000049630

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 59 116 2.6e-11 PFAM
C1Q 120 255 2.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114796
SMART Domains Protein: ENSMUSP00000110444
Gene: ENSMUSG00000026730

DomainStartEndE-ValueType
Pfam:PTE 15 62 1.9e-13 PFAM
Pfam:PTE 52 253 4.6e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134794
AA Change: L326H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117009
Gene: ENSMUSG00000026730
AA Change: L326H

DomainStartEndE-ValueType
Pfam:PTE 15 347 1e-153 PFAM
Pfam:TatD_DNase 67 300 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154269
SMART Domains Protein: ENSMUSP00000118645
Gene: ENSMUSG00000026730

DomainStartEndE-ValueType
Pfam:PTE 15 181 1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195521
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Pter
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0015:Pter UTSW 2 13001000 missense probably damaging 1.00
R0015:Pter UTSW 2 13001000 missense probably damaging 1.00
R0325:Pter UTSW 2 13000937 missense probably damaging 1.00
R0383:Pter UTSW 2 13000942 nonsense probably null
R1452:Pter UTSW 2 12978621 splice site probably benign
R1538:Pter UTSW 2 12978606 missense probably benign 0.02
R1699:Pter UTSW 2 12994761 missense probably damaging 0.97
R2083:Pter UTSW 2 12978436 missense probably damaging 1.00
R5707:Pter UTSW 2 12978180 utr 5 prime probably benign
R6267:Pter UTSW 2 12978541 missense probably damaging 1.00
R6298:Pter UTSW 2 12978394 missense probably damaging 1.00
R6329:Pter UTSW 2 12980548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGCATGTACAGGAGTG -3'
(R):5'- GTGACCATTCACCAGTTCTATGTAG -3'

Sequencing Primer
(F):5'- GTGAAAGGTAACATCTCACATGTG -3'
(R):5'- CATTCACCAGTTCTATGTAGACTGG -3'
Posted On2015-02-18