Incidental Mutation 'R3437:Amy1'
List |< first << previous [record 3 of 44] next >> last >|
ID267221
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Nameamylase 1, salivary
SynonymsAmy-1
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location113555710-113606699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113556009 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 504 (A504V)
Ref Sequence ENSEMBL: ENSMUSP00000102150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540]
Predicted Effect probably damaging
Transcript: ENSMUST00000067980
AA Change: A504V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264
AA Change: A504V

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106540
AA Change: A504V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264
AA Change: A504V

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172885
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113556132 missense probably damaging 1.00
IGL00966:Amy1 APN 3 113556040 missense probably benign 0.00
IGL01153:Amy1 APN 3 113556075 missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113563585 missense probably benign 0.27
IGL02555:Amy1 APN 3 113564892 missense probably benign 0.01
IGL02572:Amy1 APN 3 113565073 splice site probably benign
IGL03215:Amy1 APN 3 113556000 missense probably benign
R0196:Amy1 UTSW 3 113569421 missense probably benign
R0230:Amy1 UTSW 3 113558430 missense probably benign 0.02
R0586:Amy1 UTSW 3 113562769 unclassified probably benign
R1789:Amy1 UTSW 3 113558165 missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113562727 missense probably null
R1922:Amy1 UTSW 3 113564895 missense probably damaging 0.97
R2080:Amy1 UTSW 3 113558094 missense probably benign 0.01
R3147:Amy1 UTSW 3 113570048 start gained probably benign
R4961:Amy1 UTSW 3 113561849 missense probably damaging 1.00
R4977:Amy1 UTSW 3 113569377 splice site probably null
R5304:Amy1 UTSW 3 113558364 missense probably damaging 1.00
R5500:Amy1 UTSW 3 113562722 missense probably damaging 1.00
R5503:Amy1 UTSW 3 113556060 missense probably benign 0.26
R5706:Amy1 UTSW 3 113556120 missense probably damaging 0.99
R5866:Amy1 UTSW 3 113561920 missense possibly damaging 0.93
R5956:Amy1 UTSW 3 113563662 missense probably benign 0.04
R6110:Amy1 UTSW 3 113561900 missense probably damaging 1.00
R6259:Amy1 UTSW 3 113569410 missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113561690 missense probably damaging 1.00
R6429:Amy1 UTSW 3 113569509 missense probably damaging 1.00
R6893:Amy1 UTSW 3 113563632 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGATGGCTTCACAAATATGAG -3'
(R):5'- TTTTCAGGGCTTTGTCAGAAAC -3'

Sequencing Primer
(F):5'- TCAAAATCCTGGGTGTAATTTTCTC -3'
(R):5'- CAGAAACTTTACAGACTGGTCTTCC -3'
Posted On2015-02-18