Incidental Mutation 'R3437:Trim14'
ID267222
Institutional Source Beutler Lab
Gene Symbol Trim14
Ensembl Gene ENSMUSG00000039853
Gene Nametripartite motif-containing 14
Synonyms
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46493781-46536141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46523739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 100 (V100I)
Ref Sequence ENSEMBL: ENSMUSP00000138876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046897] [ENSMUST00000102924] [ENSMUST00000184112]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046897
AA Change: V100I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038719
Gene: ENSMUSG00000039853
AA Change: V100I

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
PRY 264 316 2.63e-13 SMART
SPRY 317 440 2.48e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102924
AA Change: V100I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099988
Gene: ENSMUSG00000039853
AA Change: V100I

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142606
Predicted Effect possibly damaging
Transcript: ENSMUST00000184112
AA Change: V100I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853
AA Change: V100I

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies and its function has not been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Trim14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Trim14 UTSW 4 46523627 missense probably damaging 0.99
R0310:Trim14 UTSW 4 46522043 missense probably damaging 0.99
R1766:Trim14 UTSW 4 46522039 missense probably benign 0.00
R3436:Trim14 UTSW 4 46523739 missense possibly damaging 0.63
R4085:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4086:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4087:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4088:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4992:Trim14 UTSW 4 46507110 missense probably damaging 1.00
R5408:Trim14 UTSW 4 46507134 missense possibly damaging 0.63
R5943:Trim14 UTSW 4 46522136 missense probably benign 0.01
R5979:Trim14 UTSW 4 46507239 missense probably damaging 0.97
R6029:Trim14 UTSW 4 46506998 missense probably benign 0.33
R6303:Trim14 UTSW 4 46522118 missense probably benign 0.00
R6304:Trim14 UTSW 4 46522118 missense probably benign 0.00
R6312:Trim14 UTSW 4 46507257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACTCAGGTGCAGTGTGA -3'
(R):5'- CCATTTTGCCAGTGCTTAGAA -3'

Sequencing Primer
(F):5'- CCCTGGTAGAGAAGTCATCCATG -3'
(R):5'- GCCAGTGCTTAGAAAAACTTTCC -3'
Posted On2015-02-18