Incidental Mutation 'R3437:Ambp'
ID267223
Institutional Source Beutler Lab
Gene Symbol Ambp
Ensembl Gene ENSMUSG00000028356
Gene Namealpha 1 microglobulin/bikunin
SynonymsUTI, Urinary Trypsin Inhibitor, ulinastatin, Itil, HI-30, Intin4, ASPI
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location63143275-63154799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63149484 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 163 (E163G)
Ref Sequence ENSEMBL: ENSMUSP00000030041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030041] [ENSMUST00000142901]
Predicted Effect probably benign
Transcript: ENSMUST00000030041
AA Change: E163G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030041
Gene: ENSMUSG00000028356
AA Change: E163G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 40 185 4.4e-32 PFAM
KU 228 281 1.55e-20 SMART
KU 284 337 4.58e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142901
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a fusion protein that undergoes proteolytic processing to generate two mature proteins: alpha-1-microglobulin (A1m) is a heme-binding plasma glycoprotein of the lipocalin superfamily of proteins that bind to hydrophobic molecules, whereas bikunin belongs to the superfamily of Kunitz-type protease inhibitors. The transgenic mice specifically lacking bikunin, but not A1m, exhibit female infertility and an increased sensitivity to lung metastasis. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female homozygotes for targeted null mutations exhibit reduced ovulation rates, oocytes lacking a zona pellucida, and a very low fertilization rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Ambp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Ambp APN 4 63154018 missense possibly damaging 0.93
IGL00769:Ambp APN 4 63144165 missense probably damaging 0.99
IGL01400:Ambp APN 4 63152722 missense probably damaging 1.00
IGL01646:Ambp APN 4 63148740 missense probably benign 0.04
IGL02338:Ambp APN 4 63143697 missense probably damaging 1.00
IGL02796:Ambp APN 4 63153932 splice site probably benign
PIT4131001:Ambp UTSW 4 63144265 missense probably damaging 1.00
R0885:Ambp UTSW 4 63151468 missense probably damaging 0.98
R1725:Ambp UTSW 4 63144276 missense possibly damaging 0.92
R1999:Ambp UTSW 4 63149429 missense possibly damaging 0.63
R2023:Ambp UTSW 4 63151465 missense probably damaging 1.00
R2290:Ambp UTSW 4 63143687 missense probably damaging 1.00
R3436:Ambp UTSW 4 63149484 missense probably benign 0.03
R4078:Ambp UTSW 4 63150443 missense probably damaging 0.98
R4409:Ambp UTSW 4 63152647 missense probably damaging 1.00
R4979:Ambp UTSW 4 63152651 missense probably benign 0.07
R6738:Ambp UTSW 4 63149474 missense probably benign
R6818:Ambp UTSW 4 63154006 nonsense probably null
R6890:Ambp UTSW 4 63150359 missense probably benign 0.44
X0057:Ambp UTSW 4 63149505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCTCTCTCAGTCTCTGTAG -3'
(R):5'- ATAAGGACCCAGGACCTATGG -3'

Sequencing Primer
(F):5'- TCTCTGTAGAGAGGGAGAGGACC -3'
(R):5'- GGCCCAGTCTCTCTCTTGGAG -3'
Posted On2015-02-18