Incidental Mutation 'R3437:Atp6v1g1'
ID267224
Institutional Source Beutler Lab
Gene Symbol Atp6v1g1
Ensembl Gene ENSMUSG00000039105
Gene NameATPase, H+ transporting, lysosomal V1 subunit G1
Synonyms1810024D14Rik, Atp6g1, Vma10, ATP6J, VAG1, lysosomal 13kDa
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location63544772-63550750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63550018 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 86 (N86S)
Ref Sequence ENSEMBL: ENSMUSP00000048770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035301]
Predicted Effect probably benign
Transcript: ENSMUST00000035301
AA Change: N86S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048770
Gene: ENSMUSG00000039105
AA Change: N86S

DomainStartEndE-ValueType
Pfam:V-ATPase_G 3 107 2e-41 PFAM
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of three V1 domain G subunit proteins. Pseudogenes of this gene have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Atp6v1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0694:Atp6v1g1 UTSW 4 63549993 missense probably benign 0.42
R1401:Atp6v1g1 UTSW 4 63548641 missense probably benign 0.42
R2086:Atp6v1g1 UTSW 4 63550067 missense probably benign 0.00
R2870:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R2870:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R2871:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R2871:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R2872:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R2872:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R2873:Atp6v1g1 UTSW 4 63550021 missense probably benign 0.00
R3436:Atp6v1g1 UTSW 4 63550018 missense probably benign
R4580:Atp6v1g1 UTSW 4 63550032 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACACAGCTTTTCTCACAGGTTAC -3'
(R):5'- CAGCTCTGTGGAGGTTTTCC -3'

Sequencing Primer
(F):5'- CATTCTCTTACTAAGGAGCCGGG -3'
(R):5'- CCTATTCTATGGGGGCAGATCTC -3'
Posted On2015-02-18