Incidental Mutation 'R3437:Angptl3'
List |< first << previous [record 4 of 44] next >> last >|
ID267225
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Nameangiopoietin-like 3
Synonymshypl
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location99030954-99046111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99033303 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 219 (K219N)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030280
AA Change: K219N

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: K219N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125546
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136091
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 99034840 missense probably damaging 0.99
IGL01859:Angptl3 APN 4 99037432 nonsense probably null
IGL02126:Angptl3 APN 4 99031501 critical splice donor site probably null
IGL02134:Angptl3 APN 4 99031112 missense probably damaging 1.00
IGL02573:Angptl3 APN 4 99037934 missense probably damaging 1.00
IGL02756:Angptl3 APN 4 99031162 missense probably damaging 1.00
IGL03369:Angptl3 APN 4 99034820 intron probably benign
R0309:Angptl3 UTSW 4 99034469 missense probably benign 0.32
R0549:Angptl3 UTSW 4 99031455 missense probably benign 0.00
R0675:Angptl3 UTSW 4 99033262 missense probably benign 0.02
R1465:Angptl3 UTSW 4 99037520 missense probably benign 0.01
R1465:Angptl3 UTSW 4 99037520 missense probably benign 0.01
R1738:Angptl3 UTSW 4 99033262 missense probably benign 0.02
R2007:Angptl3 UTSW 4 99037397 missense probably damaging 0.99
R2656:Angptl3 UTSW 4 99037964 missense probably benign 0.01
R3436:Angptl3 UTSW 4 99033303 missense probably benign 0.24
R3615:Angptl3 UTSW 4 99034465 missense probably benign 0.06
R3616:Angptl3 UTSW 4 99034465 missense probably benign 0.06
R4161:Angptl3 UTSW 4 99031491 missense probably damaging 0.99
R4534:Angptl3 UTSW 4 99037995 missense possibly damaging 0.73
R4615:Angptl3 UTSW 4 99031361 missense probably benign 0.03
R4835:Angptl3 UTSW 4 99037412 missense probably benign 0.36
R5308:Angptl3 UTSW 4 99034486 missense probably benign 0.33
R5413:Angptl3 UTSW 4 99031022 missense probably benign 0.12
R5668:Angptl3 UTSW 4 99032084 critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 99037567 missense probably benign 0.07
R6520:Angptl3 UTSW 4 99037848 missense probably benign 0.35
R6544:Angptl3 UTSW 4 99031438 missense probably damaging 1.00
R6762:Angptl3 UTSW 4 99037417 missense possibly damaging 0.91
Z1088:Angptl3 UTSW 4 99034520 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTCAAGAACAGAATGTCAGTC -3'
(R):5'- AACATTTGGTGATGGCATTTGC -3'

Sequencing Primer
(F):5'- TTGCTTGCTCGCAGAACG -3'
(R):5'- GAGAAAACTGCCCGGATT -3'
Posted On2015-02-18