Incidental Mutation 'R3437:Wnt16'
ID267233
Institutional Source Beutler Lab
Gene Symbol Wnt16
Ensembl Gene ENSMUSG00000029671
Gene Namewingless-type MMTV integration site family, member 16
SynonymsE130309I19Rik
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location22288227-22298522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22298134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 333 (V333A)
Ref Sequence ENSEMBL: ENSMUSP00000031681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031681] [ENSMUST00000128245] [ENSMUST00000148639]
Predicted Effect probably damaging
Transcript: ENSMUST00000031681
AA Change: V333A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031681
Gene: ENSMUSG00000029671
AA Change: V333A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 364 1.13e-146 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128245
SMART Domains Protein: ENSMUSP00000134822
Gene: ENSMUSG00000029671

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.04e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148639
SMART Domains Protein: ENSMUSP00000135016
Gene: ENSMUSG00000029671

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.61e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176681
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone mineral density, cortical bone thickness and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Wnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Wnt16 APN 6 22291013 missense probably damaging 1.00
IGL01306:Wnt16 APN 6 22297935 missense probably damaging 0.99
IGL02297:Wnt16 APN 6 22297991 nonsense probably null
ANU23:Wnt16 UTSW 6 22297935 missense probably damaging 0.99
R0320:Wnt16 UTSW 6 22297993 missense possibly damaging 0.68
R1671:Wnt16 UTSW 6 22298179 missense probably damaging 1.00
R2342:Wnt16 UTSW 6 22288924 missense probably damaging 1.00
R3786:Wnt16 UTSW 6 22298022 missense probably benign
R5301:Wnt16 UTSW 6 22297849 missense probably damaging 0.99
R5357:Wnt16 UTSW 6 22291232 intron probably benign
R5468:Wnt16 UTSW 6 22291161 missense probably benign 0.00
R5843:Wnt16 UTSW 6 22290948 missense probably damaging 0.99
R6655:Wnt16 UTSW 6 22290966 missense probably damaging 1.00
R6731:Wnt16 UTSW 6 22297892 nonsense probably null
R6988:Wnt16 UTSW 6 22288511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGTGAAAACCTGCTGG -3'
(R):5'- ACTTCCCCATCAGTGCACAG -3'

Sequencing Primer
(F):5'- ACCTGCTGGAAAACTATGTCTTC -3'
(R):5'- CCATCAGTGCACAGTAGGG -3'
Posted On2015-02-18