Incidental Mutation 'R3437:Fabp1'
ID267235
Institutional Source Beutler Lab
Gene Symbol Fabp1
Ensembl Gene ENSMUSG00000054422
Gene Namefatty acid binding protein 1, liver
SynonymsL-FABP, Fabpl
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71199827-71205023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71201611 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 24 (L24P)
Ref Sequence ENSEMBL: ENSMUSP00000064655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067492]
Predicted Effect probably benign
Transcript: ENSMUST00000067492
AA Change: L24P

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064655
Gene: ENSMUSG00000054422
AA Change: L24P

DomainStartEndE-ValueType
Pfam:Lipocalin_7 1 127 1.2e-32 PFAM
Pfam:Lipocalin 4 127 8.6e-17 PFAM
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene do not show any obvious morphological, behavioral, or reproductive abnormalities. Changes may be observed in lipid composition, lipid binding, or levels of lipid binding proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Fabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Fabp1 APN 6 71203144 missense probably damaging 1.00
R0422:Fabp1 UTSW 6 71203093 missense possibly damaging 0.92
R5218:Fabp1 UTSW 6 71199960 missense probably damaging 0.99
X0063:Fabp1 UTSW 6 71201622 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACAGAGGGAAGGGTCTTTAC -3'
(R):5'- GGAGGTGGAACTACATACCTTG -3'

Sequencing Primer
(F):5'- TTGCCTAGCATGCATGAAGC -3'
(R):5'- GTGGAACTACATACCTTGACTTTTTC -3'
Posted On2015-02-18