Incidental Mutation 'R3437:A2m'
ID267236
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 040655-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationunclassified (906 bp from exon)
DNA Base Change (assembly) T to G at 121639294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203] [ENSMUST00000204850]
Predicted Effect probably null
Transcript: ENSMUST00000032203
AA Change: L127R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: L127R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204850
Meta Mutation Damage Score 0.6408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAACTTCCCAGAAGAGAATG -3'
(R):5'- TCTTGACCAATCCTATCGGC -3'

Sequencing Primer
(F):5'- CTTCCCAGAAGAGAATGAAGGGAGC -3'
(R):5'- TCCTATCGGCGGGCAATAAAAAC -3'
Posted On2015-02-18