Incidental Mutation 'R3437:Bicra'
ID267237
Institutional Source Beutler Lab
Gene Symbol Bicra
Ensembl Gene ENSMUSG00000070808
Gene NameBRD4 interacting chromatin remodeling complex associated protein
SynonymsGltscr1
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location15970672-16047921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15989298 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 98 (D98G)
Ref Sequence ENSEMBL: ENSMUSP00000148012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094821
AA Change: D98G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: D98G

DomainStartEndE-ValueType
low complexity region 86 96 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
internal_repeat_1 156 298 1.03e-6 PROSPERO
low complexity region 308 323 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
internal_repeat_1 479 614 1.03e-6 PROSPERO
low complexity region 619 638 N/A INTRINSIC
low complexity region 642 676 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 756 782 N/A INTRINSIC
low complexity region 790 819 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 852 906 N/A INTRINSIC
low complexity region 940 950 N/A INTRINSIC
low complexity region 987 1006 N/A INTRINSIC
Pfam:GLTSCR1 1094 1202 4.6e-43 PFAM
low complexity region 1232 1251 N/A INTRINSIC
low complexity region 1275 1294 N/A INTRINSIC
low complexity region 1349 1371 N/A INTRINSIC
low complexity region 1460 1473 N/A INTRINSIC
low complexity region 1535 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210713
Predicted Effect possibly damaging
Transcript: ENSMUST00000210781
AA Change: D98G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Bicra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Bicra APN 7 15996577 missense possibly damaging 0.70
IGL01521:Bicra APN 7 15989188 missense probably benign 0.18
IGL01690:Bicra APN 7 15987753 missense probably benign 0.09
IGL01721:Bicra APN 7 15988699 missense probably benign
IGL01994:Bicra APN 7 15972816 missense possibly damaging 0.46
IGL02084:Bicra APN 7 15987738 missense probably benign 0.09
IGL02312:Bicra APN 7 15993141 missense possibly damaging 0.85
IGL02686:Bicra APN 7 15987915 missense probably benign 0.02
IGL02727:Bicra APN 7 15979465 missense possibly damaging 0.95
IGL03031:Bicra APN 7 15975801 missense probably benign 0.16
R0003:Bicra UTSW 7 15971887 missense probably benign
R0025:Bicra UTSW 7 15987511 missense possibly damaging 0.53
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0417:Bicra UTSW 7 15972322 missense probably damaging 1.00
R0437:Bicra UTSW 7 15988762 missense possibly damaging 0.73
R0547:Bicra UTSW 7 15972248 missense probably damaging 1.00
R0688:Bicra UTSW 7 15989322 missense probably damaging 1.00
R0855:Bicra UTSW 7 15972004 missense probably damaging 1.00
R1448:Bicra UTSW 7 15988359 missense possibly damaging 0.86
R1637:Bicra UTSW 7 15972689 missense probably benign 0.19
R1899:Bicra UTSW 7 15987751 missense possibly damaging 0.53
R2035:Bicra UTSW 7 15996413 missense possibly damaging 0.53
R2247:Bicra UTSW 7 15989234 missense probably benign 0.33
R2471:Bicra UTSW 7 15972332 missense probably benign 0.04
R2484:Bicra UTSW 7 15988680 missense possibly damaging 0.96
R3551:Bicra UTSW 7 15979733 missense probably benign 0.33
R4816:Bicra UTSW 7 15988906 missense possibly damaging 0.53
R4901:Bicra UTSW 7 15987601 missense possibly damaging 0.53
R5035:Bicra UTSW 7 15979424 missense possibly damaging 0.90
R5078:Bicra UTSW 7 15975457 missense probably damaging 1.00
R5094:Bicra UTSW 7 15975371 missense probably damaging 1.00
R5195:Bicra UTSW 7 15979953 missense possibly damaging 0.93
R5496:Bicra UTSW 7 15987841 missense probably benign 0.33
R5780:Bicra UTSW 7 15979754 missense possibly damaging 0.96
R6541:Bicra UTSW 7 15979129 missense probably benign 0.00
R6561:Bicra UTSW 7 15989194 missense possibly damaging 0.53
R6575:Bicra UTSW 7 15979131 missense probably benign 0.25
R6854:Bicra UTSW 7 15988762 missense probably benign 0.18
R6967:Bicra UTSW 7 15972205 missense probably damaging 0.97
X0064:Bicra UTSW 7 15975775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTTGACCACATCCTGGG -3'
(R):5'- CAGAGTGTCCCTTTGTTGACC -3'

Sequencing Primer
(F):5'- TTGCAGCCCCAGCAGATC -3'
(R):5'- AGTGTCCCTTTGTTGACCTCAGC -3'
Posted On2015-02-18