Incidental Mutation 'R3437:Slc8a2'
List |< first << previous [record 31 of 44] next >> last >|
ID267238
Institutional Source Beutler Lab
Gene Symbol Slc8a2
Ensembl Gene ENSMUSG00000030376
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 2
SynonymsNcx2
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16129826-16161063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16158885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 824 (V824G)
Ref Sequence ENSEMBL: ENSMUSP00000147497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]
Predicted Effect probably damaging
Transcript: ENSMUST00000168693
AA Change: V818G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: V818G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211649
AA Change: V824G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Slc8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Slc8a2 APN 7 16158893 missense probably damaging 1.00
IGL02097:Slc8a2 APN 7 16157156 missense possibly damaging 0.88
IGL02744:Slc8a2 APN 7 16145029 missense possibly damaging 0.91
R0281:Slc8a2 UTSW 7 16140989 missense probably benign
R0513:Slc8a2 UTSW 7 16157339 missense probably damaging 1.00
R0811:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0812:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0940:Slc8a2 UTSW 7 16144962 missense probably benign 0.04
R1167:Slc8a2 UTSW 7 16157387 missense possibly damaging 0.58
R1508:Slc8a2 UTSW 7 16140597 missense probably benign 0.00
R1655:Slc8a2 UTSW 7 16141135 missense probably damaging 1.00
R1917:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R1919:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R2051:Slc8a2 UTSW 7 16141015 missense probably damaging 1.00
R2083:Slc8a2 UTSW 7 16134515 missense probably damaging 1.00
R2128:Slc8a2 UTSW 7 16140492 splice site probably null
R2149:Slc8a2 UTSW 7 16159164 missense probably damaging 1.00
R3618:Slc8a2 UTSW 7 16152899 missense possibly damaging 0.48
R4645:Slc8a2 UTSW 7 16134239 missense probably damaging 1.00
R4741:Slc8a2 UTSW 7 16134308 missense probably damaging 1.00
R4936:Slc8a2 UTSW 7 16134175 nonsense probably null
R5071:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5072:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5074:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5150:Slc8a2 UTSW 7 16145176 missense possibly damaging 0.74
R5358:Slc8a2 UTSW 7 16157303 missense probably damaging 1.00
R5839:Slc8a2 UTSW 7 16134487 missense probably damaging 1.00
R5957:Slc8a2 UTSW 7 16145284 missense possibly damaging 0.90
R6273:Slc8a2 UTSW 7 16145334 missense possibly damaging 0.94
R6363:Slc8a2 UTSW 7 16134045 missense probably benign 0.00
R6881:Slc8a2 UTSW 7 16157357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCATGAAGACCGATCCC -3'
(R):5'- GGTCCAAGAGCAAATGCCAC -3'

Sequencing Primer
(F):5'- TCCCAAAGGAAGTAGGCAATGGTC -3'
(R):5'- TAGAAGCCCCGGATGTGG -3'
Posted On2015-02-18