Incidental Mutation 'R3437:Mrgpra3'
List |< first << previous [record 19 of 44] next >> last >|
ID267240
Institutional Source Beutler Lab
Gene Symbol Mrgpra3
Ensembl Gene ENSMUSG00000078698
Gene NameMAS-related GPR, member A3
SynonymsG protein-coupled receptor, MrgA3
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.039) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47588950-47601372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47589566 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 204 (L204W)
Ref Sequence ENSEMBL: ENSMUSP00000135437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176369]
Predicted Effect probably damaging
Transcript: ENSMUST00000176369
AA Change: L204W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135437
Gene: ENSMUSG00000078698
AA Change: L204W

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 234 6.3e-7 PFAM
Pfam:7tm_1 57 286 2.7e-9 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Mrgpra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mrgpra3 APN 7 47589519 missense probably benign 0.00
IGL02097:Mrgpra3 APN 7 47589456 missense possibly damaging 0.94
IGL02101:Mrgpra3 APN 7 47589552 missense probably damaging 0.99
IGL03071:Mrgpra3 APN 7 47589181 utr 3 prime probably benign
R0828:Mrgpra3 UTSW 7 47590136 missense probably benign 0.12
R1118:Mrgpra3 UTSW 7 47589291 missense possibly damaging 0.83
R1835:Mrgpra3 UTSW 7 47589946 nonsense probably null
R2258:Mrgpra3 UTSW 7 47590094 missense probably benign 0.35
R2393:Mrgpra3 UTSW 7 47589617 missense possibly damaging 0.92
R3973:Mrgpra3 UTSW 7 47589666 missense probably benign 0.22
R4273:Mrgpra3 UTSW 7 47589432 missense probably benign 0.01
R4495:Mrgpra3 UTSW 7 47590065 missense probably benign 0.00
R4768:Mrgpra3 UTSW 7 47589728 missense possibly damaging 0.94
R4822:Mrgpra3 UTSW 7 47589968 missense possibly damaging 0.69
R4967:Mrgpra3 UTSW 7 47589519 missense probably benign 0.33
R5207:Mrgpra3 UTSW 7 47590161 missense probably benign 0.06
R5569:Mrgpra3 UTSW 7 47590011 missense probably benign 0.00
R5763:Mrgpra3 UTSW 7 47589607 nonsense probably null
R6102:Mrgpra3 UTSW 7 47590149 missense possibly damaging 0.92
R6612:Mrgpra3 UTSW 7 47590035 missense probably benign 0.00
R6718:Mrgpra3 UTSW 7 47589696 missense probably benign 0.25
R6859:Mrgpra3 UTSW 7 47590033 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAGGTGCAATCCAGAATAACAGG -3'
(R):5'- TGAGCATGCTCAGTGCCATC -3'

Sequencing Primer
(F):5'- TAACAGGAACCAGGTGATGCCC -3'
(R):5'- ATCTGGTATCACTGCCGCCG -3'
Posted On2015-02-18