Incidental Mutation 'R3437:P4ha3'
ID267241
Institutional Source Beutler Lab
Gene Symbol P4ha3
Ensembl Gene ENSMUSG00000051048
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R3437 (G1)
Quality Score97
Status Not validated
Chromosome7
Chromosomal Location100285520-100319699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100285624 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 31 (A31V)
Ref Sequence ENSEMBL: ENSMUSP00000055297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000139790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057023
AA Change: A31V

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048
AA Change: A31V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139790
AA Change: A31V
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048
AA Change: A31V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148620
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in P4ha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:P4ha3 APN 7 100305933 missense probably damaging 1.00
IGL01875:P4ha3 APN 7 100300652 missense probably damaging 0.97
IGL02265:P4ha3 APN 7 100293932 missense probably benign
IGL02957:P4ha3 APN 7 100318905
IGL03279:P4ha3 APN 7 100300686 missense probably damaging 1.00
R0006:P4ha3 UTSW 7 100318948 nonsense probably null
R0880:P4ha3 UTSW 7 100305909 missense probably benign 0.06
R1066:P4ha3 UTSW 7 100318063 missense possibly damaging 0.77
R1118:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1119:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1236:P4ha3 UTSW 7 100293849 missense probably damaging 1.00
R1613:P4ha3 UTSW 7 100313250 missense possibly damaging 0.95
R1778:P4ha3 UTSW 7 100300691 splice site probably null
R2042:P4ha3 UTSW 7 100300690 critical splice donor site probably null
R4393:P4ha3 UTSW 7 100305607 missense probably benign 0.06
R5411:P4ha3 UTSW 7 100293815 missense probably damaging 1.00
R5722:P4ha3 UTSW 7 100305991 missense probably benign 0.03
R6209:P4ha3 UTSW 7 100317085 missense probably benign 0.09
R6462:P4ha3 UTSW 7 100314666 missense probably damaging 1.00
R6606:P4ha3 UTSW 7 100305644 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATTCAGTGCTGAGGGGAC -3'
(R):5'- CACATGACAGTTGGGTCTGG -3'

Sequencing Primer
(F):5'- GACGGAGGCGGCCAAGG -3'
(R):5'- GAAGTCACTTTGGGCCTCAGTTAC -3'
Posted On2015-02-18