Incidental Mutation 'R3437:Washc4'
ID267244
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83570002 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 454 (I454N)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably benign
Transcript: ENSMUST00000038388
AA Change: I454N

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: I454N

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTGGCTTGAAAAGGGACATTG -3'
(R):5'- TCCCAAGTTTGTATTCTGATGCAAC -3'

Sequencing Primer
(F):5'- AGGACCCGTGTTTAATCCAG -3'
(R):5'- TTCTGATGCAACCAGAAAGCAAAAC -3'
Posted On2015-02-18