Incidental Mutation 'R3437:Olfr312'
ID267246
Institutional Source Beutler Lab
Gene Symbol Olfr312
Ensembl Gene ENSMUSG00000096806
Gene Nameolfactory receptor 312
SynonymsGA_x6K02T2NKPP-575829-574903, MOR222-4P
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58829237-58834780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58831324 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 57 (M57L)
Ref Sequence ENSEMBL: ENSMUSP00000149697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078217] [ENSMUST00000216407]
Predicted Effect probably damaging
Transcript: ENSMUST00000078217
AA Change: M57L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077344
Gene: ENSMUSG00000096806
AA Change: M57L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.9e-8 PFAM
Pfam:7tm_1 39 288 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216407
AA Change: M57L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Olfr312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Olfr312 APN 11 58831639 missense probably damaging 1.00
R0442:Olfr312 UTSW 11 58831431 nonsense probably null
R0540:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R0607:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R2366:Olfr312 UTSW 11 58831213 missense probably benign 0.00
R4135:Olfr312 UTSW 11 58831994 missense probably damaging 1.00
R4391:Olfr312 UTSW 11 58832015 missense possibly damaging 0.81
R5557:Olfr312 UTSW 11 58831987 missense probably benign 0.01
R5564:Olfr312 UTSW 11 58831213 nonsense probably null
R5854:Olfr312 UTSW 11 58831556 missense probably damaging 0.99
R6791:Olfr312 UTSW 11 58832077 missense probably benign
X0067:Olfr312 UTSW 11 58831988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCAGACATGTCCAATCAC -3'
(R):5'- ATGGTTCCATAGATCAGTGGTCTG -3'

Sequencing Primer
(F):5'- GCAGACATGTCCAATCACACAAGAG -3'
(R):5'- TCATAAGCCATGGCCGTGAG -3'
Posted On2015-02-18