Incidental Mutation 'R3437:Cyp11b2'
List |< first << previous [record 10 of 44] next >> last >|
ID267254
Institutional Source Beutler Lab
Gene Symbol Cyp11b2
Ensembl Gene ENSMUSG00000022589
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 2
SynonymsCyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3437 (G1)
Quality Score208
Status Validated
Chromosome15
Chromosomal Location74851010-74856318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74855449 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 128 (R128G)
Ref Sequence ENSEMBL: ENSMUSP00000131503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167634]
Predicted Effect probably benign
Transcript: ENSMUST00000167634
AA Change: R128G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: R128G

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 498 1e-115 PFAM
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Cyp11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Cyp11b2 APN 15 74853515 missense probably benign 0.00
IGL02058:Cyp11b2 APN 15 74853189 missense probably benign 0.30
IGL02419:Cyp11b2 APN 15 74851055 missense probably damaging 1.00
IGL03094:Cyp11b2 APN 15 74853037 critical splice donor site probably null
IGL03237:Cyp11b2 APN 15 74851065 missense probably benign 0.00
R0522:Cyp11b2 UTSW 15 74851684 splice site probably benign
R0674:Cyp11b2 UTSW 15 74855544 missense probably damaging 1.00
R0837:Cyp11b2 UTSW 15 74853641 missense probably damaging 1.00
R1386:Cyp11b2 UTSW 15 74851775 critical splice acceptor site probably null
R1423:Cyp11b2 UTSW 15 74853130 missense probably damaging 1.00
R1550:Cyp11b2 UTSW 15 74853593 missense probably benign 0.07
R3693:Cyp11b2 UTSW 15 74856008 missense probably benign 0.00
R4447:Cyp11b2 UTSW 15 74855563 missense probably benign 0.00
R4870:Cyp11b2 UTSW 15 74853146 missense probably benign 0.00
R4947:Cyp11b2 UTSW 15 74851570 missense possibly damaging 0.46
R4968:Cyp11b2 UTSW 15 74854005 splice site probably null
R5115:Cyp11b2 UTSW 15 74855428 critical splice donor site probably null
R5775:Cyp11b2 UTSW 15 74853478 missense probably benign 0.02
R6738:Cyp11b2 UTSW 15 74853514 missense possibly damaging 0.65
R6841:Cyp11b2 UTSW 15 74855491 missense probably benign 0.00
R6942:Cyp11b2 UTSW 15 74856245 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTAGAAAAGCGTATTTGCAGCAGC -3'
(R):5'- GCATTCCACTTACAGCAGGG -3'

Sequencing Primer
(F):5'- CAGCAGCTTGGGGCAAG -3'
(R):5'- ACTTACAGCAGGGCTCTGTG -3'
Posted On2015-02-18