Incidental Mutation 'R3437:Olfr136'
ID267258
Institutional Source Beutler Lab
Gene Symbol Olfr136
Ensembl Gene ENSMUSG00000096840
Gene Nameolfactory receptor 136
SynonymsGA_x6K02T2PSCP-2779375-2780313, MOR256-7
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38329831-38336643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38335432 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 92 (I92V)
Ref Sequence ENSEMBL: ENSMUSP00000149856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]
Predicted Effect probably damaging
Transcript: ENSMUST00000077203
AA Change: I92V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: I92V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-48 PFAM
Pfam:7tm_1 41 290 7.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208525
AA Change: I92V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208539
AA Change: I92V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214035
AA Change: I92V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216963
AA Change: I92V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Olfr136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Olfr136 APN 17 38335957 missense probably benign 0.00
IGL01787:Olfr136 APN 17 38335579 missense probably damaging 0.98
IGL02480:Olfr136 APN 17 38335423 missense probably benign 0.32
IGL02603:Olfr136 APN 17 38335513 missense probably damaging 1.00
IGL03122:Olfr136 APN 17 38335301 missense probably benign 0.01
R0295:Olfr136 UTSW 17 38335291 missense probably damaging 1.00
R0684:Olfr136 UTSW 17 38335844 missense probably benign 0.11
R1874:Olfr136 UTSW 17 38335969 missense probably damaging 1.00
R3436:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R4714:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4715:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4716:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4878:Olfr136 UTSW 17 38335627 missense probably benign
R5296:Olfr136 UTSW 17 38335456 nonsense probably null
R5370:Olfr136 UTSW 17 38335444 nonsense probably null
R5413:Olfr136 UTSW 17 38335624 missense probably benign 0.03
R5988:Olfr136 UTSW 17 38336020 missense probably damaging 1.00
R6156:Olfr136 UTSW 17 38335173 missense probably damaging 0.99
R6550:Olfr136 UTSW 17 38336005 missense possibly damaging 0.65
V5088:Olfr136 UTSW 17 38335159 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- CTGGGCTTTGCTAACCATCC -3'
(R):5'- GCAAAGATCACGCCAGTCAG -3'

Sequencing Primer
(F):5'- TCTGATAACATATCCCATGGCTTTG -3'
(R):5'- CGCCAGTCAGCCACATAATAG -3'
Posted On2015-02-18