Incidental Mutation 'R3437:Zfy1'
ID267261
Institutional Source Beutler Lab
Gene Symbol Zfy1
Ensembl Gene ENSMUSG00000053211
Gene Namezinc finger protein 1, Y-linked
SynonymsZfy-1
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3437 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location725128-797409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 726357 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 469 (D469E)
Ref Sequence ENSEMBL: ENSMUSP00000140600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065545] [ENSMUST00000189888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065545
AA Change: D469E

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069364
Gene: ENSMUSG00000053211
AA Change: D469E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-109 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189888
AA Change: D469E

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140600
Gene: ENSMUSG00000053211
AA Change: D469E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 1.2e-141 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Other mutations in Zfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0149:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0361:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0529:Zfy1 UTSW Y 726040 missense probably damaging 1.00
R0837:Zfy1 UTSW Y 725850 nonsense probably null
R0945:Zfy1 UTSW Y 725983 missense probably damaging 0.98
R1163:Zfy1 UTSW Y 725611 missense probably damaging 0.98
R1394:Zfy1 UTSW Y 725957 missense possibly damaging 0.79
R1806:Zfy1 UTSW Y 725620 missense possibly damaging 0.88
R1928:Zfy1 UTSW Y 729733 missense unknown
R2374:Zfy1 UTSW Y 726391 missense probably damaging 0.99
R2374:Zfy1 UTSW Y 726392 missense possibly damaging 0.77
R2889:Zfy1 UTSW Y 726307 missense possibly damaging 0.95
R2980:Zfy1 UTSW Y 739054 missense unknown
R4454:Zfy1 UTSW Y 725518 missense possibly damaging 0.86
R4529:Zfy1 UTSW Y 726511 missense possibly damaging 0.93
R4656:Zfy1 UTSW Y 729626 missense unknown
R5049:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R5087:Zfy1 UTSW Y 732964 missense unknown
R5347:Zfy1 UTSW Y 725950 missense possibly damaging 0.90
R5428:Zfy1 UTSW Y 726205 missense possibly damaging 0.95
R5825:Zfy1 UTSW Y 726531 missense possibly damaging 0.85
R6256:Zfy1 UTSW Y 738765 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTGACGGAAACCTTTACC -3'
(R):5'- ACAAACTTTACGTGTCTATCCTTGC -3'

Sequencing Primer
(F):5'- GGTGACGGAAACCTTTACCACATTC -3'
(R):5'- ACGTGTCTATCCTTGCATGTTTTG -3'
Posted On2015-02-18