Incidental Mutation 'R3437:Uty'
List |< first << previous [record 37 of 44] next >> last >|
ID267262
Institutional Source Beutler Lab
Gene Symbol Uty
Ensembl Gene ENSMUSG00000068457
Gene Nameubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
SynonymsHydb
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3437 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location1096861-1245759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 1158336 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 522 (I522T)
Ref Sequence ENSEMBL: ENSMUSP00000119406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069309] [ENSMUST00000137048] [ENSMUST00000139365] [ENSMUST00000143286] [ENSMUST00000143958] [ENSMUST00000154004] [ENSMUST00000154666]
Predicted Effect probably benign
Transcript: ENSMUST00000069309
AA Change: I570T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070012
Gene: ENSMUSG00000068457
AA Change: I570T

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 88 121 1.51e1 SMART
TPR 125 158 2.26e-3 SMART
TPR 200 233 2.31e0 SMART
TPR 279 312 6.19e-1 SMART
TPR 313 346 4.21e-3 SMART
TPR 347 380 8.97e0 SMART
Blast:JmjC 389 470 2e-28 BLAST
low complexity region 534 551 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 784 795 N/A INTRINSIC
JmjC 907 1070 5.22e-47 SMART
Blast:JmjC 1106 1170 1e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133976
Predicted Effect probably benign
Transcript: ENSMUST00000137048
AA Change: I522T

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119406
Gene: ENSMUSG00000068457
AA Change: I522T

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 85 118 1.51e1 SMART
TPR 122 155 2.26e-3 SMART
TPR 197 230 2.31e0 SMART
TPR 276 309 6.19e-1 SMART
TPR 310 343 4.21e-3 SMART
TPR 344 377 8.97e0 SMART
Blast:JmjC 452 647 6e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139365
AA Change: I569T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114752
Gene: ENSMUSG00000068457
AA Change: I569T

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
TPR 87 120 1.51e1 SMART
TPR 124 157 2.26e-3 SMART
TPR 199 232 2.31e0 SMART
TPR 278 311 6.19e-1 SMART
TPR 312 345 4.21e-3 SMART
TPR 346 379 8.97e0 SMART
Blast:JmjC 388 469 2e-28 BLAST
low complexity region 533 550 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
JmjC 906 1069 5.22e-47 SMART
Blast:JmjC 1105 1169 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143286
AA Change: I469T

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115113
Gene: ENSMUSG00000068457
AA Change: I469T

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
TPR 69 102 2.26e-3 SMART
TPR 144 177 2.31e0 SMART
TPR 223 256 6.19e-1 SMART
TPR 257 290 4.21e-3 SMART
TPR 291 324 8.97e0 SMART
low complexity region 433 450 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 683 694 N/A INTRINSIC
JmjC 806 969 5.22e-47 SMART
Blast:JmjC 1005 1069 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143958
SMART Domains Protein: ENSMUSP00000120069
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154004
AA Change: I507T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114910
Gene: ENSMUSG00000068457
AA Change: I507T

DomainStartEndE-ValueType
TPR 25 58 1.51e1 SMART
TPR 62 95 2.26e-3 SMART
TPR 137 170 2.31e0 SMART
TPR 216 249 6.19e-1 SMART
TPR 250 283 4.21e-3 SMART
TPR 284 317 8.97e0 SMART
Blast:JmjC 326 407 2e-28 BLAST
low complexity region 471 488 N/A INTRINSIC
low complexity region 568 583 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 668 681 N/A INTRINSIC
low complexity region 721 732 N/A INTRINSIC
JmjC 844 1007 5.22e-47 SMART
Blast:JmjC 1043 1107 1e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154666
SMART Domains Protein: ENSMUSP00000122818
Gene: ENSMUSG00000068457

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Meta Mutation Damage Score 0.1612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mutant male mice hemizygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Uty
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Uty UTSW Y 1197223 missense probably damaging 1.00
R0277:Uty UTSW Y 1169979 missense probably damaging 1.00
R0323:Uty UTSW Y 1169979 missense probably damaging 1.00
R1102:Uty UTSW Y 1174741 missense probably damaging 1.00
R1256:Uty UTSW Y 1134884 missense probably damaging 0.96
R1499:Uty UTSW Y 1197228 missense probably damaging 1.00
R1534:Uty UTSW Y 1245440 missense probably benign 0.41
R1643:Uty UTSW Y 1152054 missense probably damaging 1.00
R2070:Uty UTSW Y 1169193 missense probably benign 0.28
R2101:Uty UTSW Y 1176541 missense probably damaging 0.99
R2146:Uty UTSW Y 1239816 missense probably benign 0.25
R2508:Uty UTSW Y 1158182 missense probably damaging 1.00
R3036:Uty UTSW Y 1099671 nonsense probably null
R3547:Uty UTSW Y 1158512 missense possibly damaging 0.78
R4153:Uty UTSW Y 1158327 missense possibly damaging 0.68
R4388:Uty UTSW Y 1151956 missense possibly damaging 0.94
R4467:Uty UTSW Y 1158372 missense possibly damaging 0.48
R4607:Uty UTSW Y 1131134 missense probably damaging 1.00
R4608:Uty UTSW Y 1131134 missense probably damaging 1.00
R4684:Uty UTSW Y 1176502 nonsense probably null
R4948:Uty UTSW Y 1136883 missense probably damaging 1.00
R5129:Uty UTSW Y 1158592 missense probably benign 0.13
R5387:Uty UTSW Y 1189339 missense probably damaging 1.00
R5408:Uty UTSW Y 1245614 missense possibly damaging 0.46
R5487:Uty UTSW Y 1174825 missense probably damaging 1.00
R5677:Uty UTSW Y 1134902 missense probably damaging 1.00
R5806:Uty UTSW Y 1170921 missense probably damaging 0.99
R6047:Uty UTSW Y 1158288 missense probably damaging 1.00
R6092:Uty UTSW Y 1174836 missense probably benign 0.08
R6759:Uty UTSW Y 1174735 missense probably damaging 0.98
R6761:Uty UTSW Y 1186790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTGGAAATGGCTGAAGAG -3'
(R):5'- GGGGATGCTCAAAATCACTTC -3'

Sequencing Primer
(F):5'- GCAGAAAGATTATCAGGCTTTTTGTG -3'
(R):5'- GGGGATGCTCAAAATCACTTCTTACG -3'
Posted On2015-02-18