Incidental Mutation 'R3438:Stk31'
ID267277
Institutional Source Beutler Lab
Gene Symbol Stk31
Ensembl Gene ENSMUSG00000023403
Gene Nameserine threonine kinase 31
SynonymsC330007K24Rik
MMRRC Submission 040656-MU
Accession Numbers

Genbank: NM_029916; MGI: 1924735

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3438 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location49395604-49469501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49437521 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 485 (S485G)
Ref Sequence ENSEMBL: ENSMUSP00000132896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024171] [ENSMUST00000163954] [ENSMUST00000172459]
Predicted Effect probably benign
Transcript: ENSMUST00000024171
AA Change: S530G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024171
Gene: ENSMUSG00000023403
AA Change: S530G

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 768 932 4.6e-9 PFAM
Pfam:Pkinase 794 973 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163954
AA Change: S530G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127545
Gene: ENSMUSG00000023403
AA Change: S530G

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 784 922 7.4e-9 PFAM
Pfam:Pkinase 794 940 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167846
SMART Domains Protein: ENSMUSP00000130561
Gene: ENSMUSG00000023403

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 105 287 1e-6 PFAM
Pfam:Pkinase 184 284 1.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172459
AA Change: S485G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132896
Gene: ENSMUSG00000023403
AA Change: S485G

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 739 890 5.2e-9 PFAM
Pfam:Pkinase 749 917 1.1e-16 PFAM
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display normal embryonic development and spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,521,524 noncoding transcript Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ampd3 T C 7: 110,803,226 I479T probably damaging Het
Aoah G A 13: 20,917,072 R254K probably benign Het
Appbp2 T C 11: 85,198,140 E358G probably damaging Het
Col6a5 A G 9: 105,875,792 S2294P possibly damaging Het
Cux1 T C 5: 136,311,560 E632G probably damaging Het
Cyp7a1 T C 4: 6,272,769 N148S probably damaging Het
Dgkz A T 2: 91,934,050 probably benign Het
Dlgap1 A T 17: 70,516,361 S114C probably damaging Het
Dmtn T A 14: 70,612,716 I263F probably damaging Het
Gigyf2 C A 1: 87,440,580 H1029N probably damaging Het
Gm10770 T A 2: 150,179,549 probably null Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lamc1 T C 1: 153,226,415 D1479G probably benign Het
Lhx4 T A 1: 155,702,484 D304V probably benign Het
Mybl1 G T 1: 9,687,645 T143K probably damaging Het
Notch3 C T 17: 32,153,590 C630Y probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1219 T C 2: 89,074,363 I243V probably benign Het
Olfr311 G T 11: 58,841,872 G253* probably null Het
Olfr922 T G 9: 38,816,216 F238V probably damaging Het
Otoa A G 7: 121,160,343 E1056G possibly damaging Het
Plin4 A G 17: 56,107,193 V144A probably benign Het
Sec16b T C 1: 157,556,758 probably benign Het
Tanc2 C T 11: 105,857,575 P511L probably damaging Het
Utrn T C 10: 12,481,318 D309G probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vsx2 A T 12: 84,570,211 Q90L probably damaging Het
Other mutations in Stk31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Stk31 APN 6 49437443 missense probably benign 0.41
IGL02479:Stk31 APN 6 49421688 missense probably damaging 0.99
IGL02490:Stk31 APN 6 49417535 missense probably benign 0.04
IGL03165:Stk31 APN 6 49445264 missense probably damaging 0.98
3-1:Stk31 UTSW 6 49417202 nonsense probably null
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0039:Stk31 UTSW 6 49442258 missense probably damaging 1.00
R0616:Stk31 UTSW 6 49423485 missense probably damaging 1.00
R0732:Stk31 UTSW 6 49417495 missense probably benign 0.00
R0975:Stk31 UTSW 6 49423409 missense probably damaging 1.00
R1127:Stk31 UTSW 6 49409207 missense probably damaging 1.00
R1705:Stk31 UTSW 6 49423384 missense possibly damaging 0.94
R1711:Stk31 UTSW 6 49469304 missense probably benign 0.10
R1892:Stk31 UTSW 6 49438474 missense probably damaging 1.00
R1942:Stk31 UTSW 6 49439127 missense probably damaging 0.98
R1953:Stk31 UTSW 6 49446478 critical splice donor site probably null
R2149:Stk31 UTSW 6 49439218 missense possibly damaging 0.80
R2281:Stk31 UTSW 6 49417250 missense probably damaging 1.00
R4681:Stk31 UTSW 6 49437435 missense probably benign 0.37
R5333:Stk31 UTSW 6 49469152 missense probably benign 0.00
R5492:Stk31 UTSW 6 49398243 missense probably damaging 1.00
R5782:Stk31 UTSW 6 49469136 missense probably benign 0.00
R5820:Stk31 UTSW 6 49417285 missense probably damaging 0.96
R5931:Stk31 UTSW 6 49469302 missense probably benign 0.05
R6012:Stk31 UTSW 6 49469309 missense probably damaging 0.96
R6254:Stk31 UTSW 6 49421697 missense probably benign 0.08
R6281:Stk31 UTSW 6 49469180 missense possibly damaging 0.93
R6294:Stk31 UTSW 6 49417344 missense probably benign 0.18
R6401:Stk31 UTSW 6 49423438 missense probably damaging 1.00
R7289:Stk31 UTSW 6 49438459 missense probably benign 0.05
Z1088:Stk31 UTSW 6 49417188 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTAACATTGTCTTTAGGACTTAGC -3'
(R):5'- ACTGGTGGTTAAGGCAAGTAGC -3'

Sequencing Primer
(F):5'- GCAACTTCTTTAGAATCAGTGTATGG -3'
(R):5'- ACAAAACCAACAATCTAACTCACTAG -3'
Posted On2015-02-18