Incidental Mutation 'R3438:Gnb1l'
ID267295
Institutional Source Beutler Lab
Gene Symbol Gnb1l
Ensembl Gene ENSMUSG00000000884
Gene Nameguanine nucleotide binding protein (G protein), beta polypeptide 1-like
SynonymsESTM55, Wdvcf, Wdr14, Me49f07
MMRRC Submission 040656-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R3438 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18498713-18566679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18552367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000130371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000904] [ENSMUST00000090086] [ENSMUST00000115600] [ENSMUST00000115601] [ENSMUST00000139625] [ENSMUST00000149035] [ENSMUST00000167778] [ENSMUST00000231621]
Predicted Effect probably benign
Transcript: ENSMUST00000000904
SMART Domains Protein: ENSMUSP00000000904
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 112 143 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000090086
AA Change: T172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087544
Gene: ENSMUSG00000000884
AA Change: T172A

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115600
SMART Domains Protein: ENSMUSP00000111263
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 136 188 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115601
SMART Domains Protein: ENSMUSP00000111264
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 138 179 1e-16 BLAST
WD40 182 221 4.79e-1 SMART
WD40 224 266 4.79e-1 SMART
WD40 269 307 6.04e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129952
Predicted Effect probably benign
Transcript: ENSMUST00000139625
AA Change: T69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120897
Gene: ENSMUSG00000000884
AA Change: T69A

DomainStartEndE-ValueType
Blast:WD40 35 75 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149035
SMART Domains Protein: ENSMUSP00000114875
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
Blast:WD40 35 76 8e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151253
Predicted Effect probably benign
Transcript: ENSMUST00000167778
AA Change: T203A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130371
Gene: ENSMUSG00000000884
AA Change: T203A

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231621
AA Change: T172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232235
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit significantly reduced prepulse inhibition. Homozygotes die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,521,524 noncoding transcript Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ampd3 T C 7: 110,803,226 I479T probably damaging Het
Aoah G A 13: 20,917,072 R254K probably benign Het
Appbp2 T C 11: 85,198,140 E358G probably damaging Het
Col6a5 A G 9: 105,875,792 S2294P possibly damaging Het
Cux1 T C 5: 136,311,560 E632G probably damaging Het
Cyp7a1 T C 4: 6,272,769 N148S probably damaging Het
Dgkz A T 2: 91,934,050 probably benign Het
Dlgap1 A T 17: 70,516,361 S114C probably damaging Het
Dmtn T A 14: 70,612,716 I263F probably damaging Het
Gigyf2 C A 1: 87,440,580 H1029N probably damaging Het
Gm10770 T A 2: 150,179,549 probably null Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lamc1 T C 1: 153,226,415 D1479G probably benign Het
Lhx4 T A 1: 155,702,484 D304V probably benign Het
Mybl1 G T 1: 9,687,645 T143K probably damaging Het
Notch3 C T 17: 32,153,590 C630Y probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1219 T C 2: 89,074,363 I243V probably benign Het
Olfr311 G T 11: 58,841,872 G253* probably null Het
Olfr922 T G 9: 38,816,216 F238V probably damaging Het
Otoa A G 7: 121,160,343 E1056G possibly damaging Het
Plin4 A G 17: 56,107,193 V144A probably benign Het
Sec16b T C 1: 157,556,758 probably benign Het
Stk31 A G 6: 49,437,521 S485G probably benign Het
Tanc2 C T 11: 105,857,575 P511L probably damaging Het
Utrn T C 10: 12,481,318 D309G probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vsx2 A T 12: 84,570,211 Q90L probably damaging Het
Other mutations in Gnb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Gnb1l APN 16 18544200 missense probably damaging 1.00
IGL02860:Gnb1l APN 16 18552535 missense probably damaging 0.99
IGL03155:Gnb1l APN 16 18540532 intron probably null
IGL03169:Gnb1l APN 16 18540455 missense probably damaging 1.00
R0017:Gnb1l UTSW 16 18541060 missense probably damaging 1.00
R0267:Gnb1l UTSW 16 18548089 splice site probably benign
R0365:Gnb1l UTSW 16 18552461 missense possibly damaging 0.95
R0845:Gnb1l UTSW 16 18552473 missense probably benign 0.01
R2975:Gnb1l UTSW 16 18564266 missense probably damaging 1.00
R3439:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R4650:Gnb1l UTSW 16 18544275 critical splice donor site probably null
R4776:Gnb1l UTSW 16 18548096 nonsense probably null
R7135:Gnb1l UTSW 16 18545168 missense probably benign 0.05
R7290:Gnb1l UTSW 16 18564056 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGCTCCTCAGGTACTAAGCAGTG -3'
(R):5'- TCCAGACAGCCAGTACCTTC -3'

Sequencing Primer
(F):5'- TACTAAGCAGTGGCCCTAGG -3'
(R):5'- TTCCCAGCAGAGCCAGAGATG -3'
Posted On2015-02-18