Incidental Mutation 'R3439:Rnpepl1'
ID267301
Institutional Source Beutler Lab
Gene Symbol Rnpepl1
Ensembl Gene ENSMUSG00000026269
Gene Namearginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92910783-92924384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92916940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 385 (T385S)
Ref Sequence ENSEMBL: ENSMUSP00000027487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027487] [ENSMUST00000178116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027487
AA Change: T385S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027487
Gene: ENSMUSG00000026269
AA Change: T385S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Pfam:Peptidase_M1 36 440 3e-58 PFAM
Leuk-A4-hydro_C 523 668 1.31e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178116
SMART Domains Protein: ENSMUSP00000136080
Gene: ENSMUSG00000026269

DomainStartEndE-ValueType
Pfam:Peptidase_M1 5 170 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178816
Predicted Effect unknown
Transcript: ENSMUST00000179127
AA Change: T50S
Predicted Effect probably benign
Transcript: ENSMUST00000179531
Predicted Effect probably benign
Transcript: ENSMUST00000179837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179854
Predicted Effect probably benign
Transcript: ENSMUST00000179993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180306
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Rnpepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Rnpepl1 APN 1 92915899 missense possibly damaging 0.69
IGL01291:Rnpepl1 APN 1 92919746 missense probably benign
IGL02266:Rnpepl1 APN 1 92916889 missense probably damaging 1.00
IGL02481:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL02483:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL03377:Rnpepl1 APN 1 92919231 missense probably benign 0.01
ANU05:Rnpepl1 UTSW 1 92919746 missense probably benign
R0069:Rnpepl1 UTSW 1 92918898 missense possibly damaging 0.91
R0409:Rnpepl1 UTSW 1 92915860 missense probably damaging 1.00
R0479:Rnpepl1 UTSW 1 92918865 unclassified probably benign
R1155:Rnpepl1 UTSW 1 92916887 missense probably damaging 1.00
R1170:Rnpepl1 UTSW 1 92919195 missense possibly damaging 0.56
R1397:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R1601:Rnpepl1 UTSW 1 92917222 missense possibly damaging 0.95
R2184:Rnpepl1 UTSW 1 92916823 missense probably benign 0.43
R2187:Rnpepl1 UTSW 1 92916895 missense probably null 1.00
R2211:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R2902:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3105:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3196:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R4887:Rnpepl1 UTSW 1 92915113 missense probably damaging 1.00
R4966:Rnpepl1 UTSW 1 92916761 missense probably damaging 1.00
R5212:Rnpepl1 UTSW 1 92911323 missense probably benign 0.03
R5214:Rnpepl1 UTSW 1 92919279 missense probably benign 0.01
R5385:Rnpepl1 UTSW 1 92917192 missense probably damaging 1.00
R5655:Rnpepl1 UTSW 1 92919310 missense probably damaging 1.00
R5694:Rnpepl1 UTSW 1 92918941 missense probably benign 0.03
R5940:Rnpepl1 UTSW 1 92917712 missense probably damaging 1.00
R6046:Rnpepl1 UTSW 1 92916821 missense probably damaging 1.00
R6086:Rnpepl1 UTSW 1 92917681 missense probably damaging 1.00
R6104:Rnpepl1 UTSW 1 92915884 missense probably benign
R6349:Rnpepl1 UTSW 1 92919841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACATCGTCTTCCTGCCG -3'
(R):5'- TGTCTCTAGGCAGGTGAAGG -3'

Sequencing Primer
(F):5'- ATCGTGGCCATGGAGAACC -3'
(R):5'- AGCCCCTGAGTGGAGTCAGAG -3'
Posted On2015-02-18