Incidental Mutation 'R3439:Tchh'
ID267305
Institutional Source Beutler Lab
Gene Symbol Tchh
Ensembl Gene ENSMUSG00000052415
Gene Nametrichohyalin
SynonymsThh, AHF
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93442330-93449077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93447393 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1380 (E1380G)
Ref Sequence ENSEMBL: ENSMUSP00000069525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064257]
Predicted Effect unknown
Transcript: ENSMUST00000064257
AA Change: E1380G
SMART Domains Protein: ENSMUSP00000069525
Gene: ENSMUSG00000052415
AA Change: E1380G

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.5e-15 PFAM
Blast:EFh 53 81 4e-9 BLAST
low complexity region 110 123 N/A INTRINSIC
coiled coil region 137 370 N/A INTRINSIC
internal_repeat_2 374 384 2.35e-6 PROSPERO
internal_repeat_1 382 400 4.53e-15 PROSPERO
low complexity region 403 431 N/A INTRINSIC
internal_repeat_2 432 442 2.35e-6 PROSPERO
low complexity region 443 469 N/A INTRINSIC
low complexity region 480 494 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
coiled coil region 516 625 N/A INTRINSIC
internal_repeat_1 627 645 4.53e-15 PROSPERO
coiled coil region 661 700 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
coiled coil region 738 821 N/A INTRINSIC
low complexity region 827 844 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 867 905 N/A INTRINSIC
coiled coil region 927 1049 N/A INTRINSIC
coiled coil region 1073 1263 N/A INTRINSIC
coiled coil region 1295 1570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Tchh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tchh APN 3 93445299 missense unknown
IGL00338:Tchh APN 3 93447644 missense unknown
IGL00541:Tchh APN 3 93446250 missense unknown
IGL02510:Tchh APN 3 93444078 missense unknown
IGL02622:Tchh APN 3 93443412 missense probably damaging 1.00
IGL03164:Tchh APN 3 93445392 missense unknown
IGL03331:Tchh APN 3 93443418 missense probably damaging 1.00
R0334:Tchh UTSW 3 93445616 missense unknown
R0603:Tchh UTSW 3 93443781 missense possibly damaging 0.91
R1186:Tchh UTSW 3 93448046 missense unknown
R1241:Tchh UTSW 3 93444972 missense unknown
R1610:Tchh UTSW 3 93444839 missense unknown
R1768:Tchh UTSW 3 93443575 missense possibly damaging 0.68
R1843:Tchh UTSW 3 93446780 missense unknown
R1866:Tchh UTSW 3 93447760 missense unknown
R1978:Tchh UTSW 3 93446799 missense unknown
R2008:Tchh UTSW 3 93445974 missense unknown
R2011:Tchh UTSW 3 93446961 missense unknown
R2087:Tchh UTSW 3 93443918 missense unknown
R2177:Tchh UTSW 3 93444132 missense unknown
R2292:Tchh UTSW 3 93442382 missense probably damaging 1.00
R2418:Tchh UTSW 3 93445629 missense unknown
R2877:Tchh UTSW 3 93444228 missense unknown
R2995:Tchh UTSW 3 93447750 small deletion probably benign
R2997:Tchh UTSW 3 93447750 small deletion probably benign
R3440:Tchh UTSW 3 93445107 missense unknown
R3441:Tchh UTSW 3 93445107 missense unknown
R4063:Tchh UTSW 3 93446991 missense unknown
R4550:Tchh UTSW 3 93445310 missense unknown
R4720:Tchh UTSW 3 93447882 missense unknown
R4836:Tchh UTSW 3 93445148 missense unknown
R4836:Tchh UTSW 3 93447588 missense unknown
R4880:Tchh UTSW 3 93443823 missense possibly damaging 0.85
R4895:Tchh UTSW 3 93445686 missense unknown
R5188:Tchh UTSW 3 93446679 missense unknown
R5404:Tchh UTSW 3 93447675 missense unknown
R5435:Tchh UTSW 3 93443672 missense possibly damaging 0.53
R5578:Tchh UTSW 3 93444311 nonsense probably null
R5678:Tchh UTSW 3 93445626 missense unknown
R5697:Tchh UTSW 3 93445043 nonsense probably null
R5768:Tchh UTSW 3 93446181 missense unknown
R5809:Tchh UTSW 3 93445573 missense unknown
R5934:Tchh UTSW 3 93444112 missense unknown
R5945:Tchh UTSW 3 93445337 missense unknown
R6313:Tchh UTSW 3 93447851 missense unknown
R6329:Tchh UTSW 3 93446445 missense unknown
R6397:Tchh UTSW 3 93445866 missense unknown
R6818:Tchh UTSW 3 93443411 missense probably damaging 1.00
Z1088:Tchh UTSW 3 93445682 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGCTCGGCCAAGAACTG -3'
(R):5'- GCGGAATCTTCTGTTGTCAC -3'

Sequencing Primer
(F):5'- CGGGACAGAAAGATCCGCC -3'
(R):5'- TGTTGTCACGCTCCTGGAGAC -3'
Posted On2015-02-18