Incidental Mutation 'R3439:Tet2'
ID267306
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
MMRRC Submission 040657-MU
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133466831 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 1890 (A1890D)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: A1882D

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: A1882D

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: A1890D

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: A1890D

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197211
Predicted Effect probably benign
Transcript: ENSMUST00000198974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199381
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAGATGCTGTGACCTGTCC -3'
(R):5'- CAGGATCTCACTTGTACTGTATAGG -3'

Sequencing Primer
(F):5'- GATGCTGTGACCTGTCCCTACG -3'
(R):5'- GTTTCTACCAAAACATTGTTTGGCTC -3'
Posted On2015-02-18