Incidental Mutation 'R3439:Gm12666'
ID267307
Institutional Source Beutler Lab
Gene Symbol Gm12666
Ensembl Gene ENSMUSG00000066107
Gene Namepredicted gene 12666
Synonyms
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location92190744-92191749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92191682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 23 (V23G)
Ref Sequence ENSEMBL: ENSMUSP00000122212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123179
AA Change: V23G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122212
Gene: ENSMUSG00000066107
AA Change: V23G

DomainStartEndE-ValueType
RRM 3 73 9.8e-9 SMART
low complexity region 87 103 N/A INTRINSIC
low complexity region 134 153 N/A INTRINSIC
low complexity region 179 188 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Gm12666
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Gm12666 APN 4 92191625 missense probably damaging 0.98
IGL01670:Gm12666 APN 4 92191500 splice site probably null
IGL02690:Gm12666 APN 4 92191011 missense probably damaging 0.98
IGL03052:Gm12666 UTSW 4 92191050 missense probably benign 0.01
R2094:Gm12666 UTSW 4 92191656 missense probably damaging 1.00
R2567:Gm12666 UTSW 4 92191323 missense probably benign 0.10
R3438:Gm12666 UTSW 4 92191682 missense possibly damaging 0.94
R4388:Gm12666 UTSW 4 92191114 missense probably benign 0.00
R4710:Gm12666 UTSW 4 92190975 missense possibly damaging 0.94
R5810:Gm12666 UTSW 4 92191583 critical splice donor site probably null
R6969:Gm12666 UTSW 4 92191589 missense probably damaging 1.00
X0067:Gm12666 UTSW 4 92191334 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAATTTGTTACTCTTGCTAACCCTG -3'
(R):5'- ACAGTTACACACAGTTATTGCCAC -3'

Sequencing Primer
(F):5'- ACTCTTGCTAACCCTGTGCTTTTTC -3'
(R):5'- AGGAGTTGCTCCCCAAAA -3'
Posted On2015-02-18