Incidental Mutation 'R3439:Plod3'
ID267312
Institutional Source Beutler Lab
Gene Symbol Plod3
Ensembl Gene ENSMUSG00000004846
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonymslysyl hydroxylase 3, LH3
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136987019-136996648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 136988146 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 50 (A50P)
Ref Sequence ENSEMBL: ENSMUSP00000004968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]
Predicted Effect probably benign
Transcript: ENSMUST00000004968
AA Change: A50P

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846
AA Change: A50P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034953
SMART Domains Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085941
SMART Domains Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:zf-HIT 113 142 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102285
Predicted Effect probably benign
Transcript: ENSMUST00000111090
SMART Domains Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111091
SMART Domains Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
Pfam:zf-HIT 117 146 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127100
SMART Domains Protein: ENSMUSP00000123550
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
Blast:P4Hc 2 35 2e-11 BLAST
P4Hc 38 200 3.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect probably benign
Transcript: ENSMUST00000137272
SMART Domains Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151642
Predicted Effect probably benign
Transcript: ENSMUST00000156963
SMART Domains Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.7e-13 PFAM
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryonic growth, fragility, and fragmented basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Plod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Plod3 APN 5 136996176 missense possibly damaging 0.78
IGL01090:Plod3 APN 5 136990236 missense probably benign 0.37
IGL01443:Plod3 APN 5 136990221 missense probably benign 0.17
IGL01583:Plod3 APN 5 136996148 missense probably benign 0.02
R0544:Plod3 UTSW 5 136991611 missense probably benign 0.09
R0747:Plod3 UTSW 5 136988195 missense probably benign 0.34
R0764:Plod3 UTSW 5 136989583 unclassified probably benign
R1520:Plod3 UTSW 5 136991311 missense probably damaging 0.99
R1631:Plod3 UTSW 5 136988993 missense probably damaging 1.00
R1751:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1767:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1984:Plod3 UTSW 5 136990853 splice site probably null
R1985:Plod3 UTSW 5 136990853 splice site probably null
R2137:Plod3 UTSW 5 136988717 missense probably damaging 1.00
R2148:Plod3 UTSW 5 136987773 nonsense probably null
R2179:Plod3 UTSW 5 136991008 missense possibly damaging 0.77
R2318:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2319:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2512:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2513:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2696:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2891:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2893:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3030:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3957:Plod3 UTSW 5 136994192 missense probably damaging 1.00
R4080:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4081:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4342:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4344:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4345:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4546:Plod3 UTSW 5 136988947 missense possibly damaging 0.94
R4799:Plod3 UTSW 5 136990800 missense probably benign 0.00
R4843:Plod3 UTSW 5 136991000 nonsense probably null
R4956:Plod3 UTSW 5 136989918 missense probably damaging 1.00
R5159:Plod3 UTSW 5 136995078 intron probably benign
R5162:Plod3 UTSW 5 136991307 missense probably damaging 1.00
R5328:Plod3 UTSW 5 136989683 missense probably damaging 1.00
R5427:Plod3 UTSW 5 136991788 missense probably damaging 1.00
R6627:Plod3 UTSW 5 136988456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCTGGAGATCAAATGTGCTG -3'
(R):5'- ACTGTTCGAGCCACATCACC -3'

Sequencing Primer
(F):5'- TGTGCTGAAAGAACTTTAGTGAAG -3'
(R):5'- CCCAGGGTCTGCAGGAAAGATC -3'
Posted On2015-02-18