Incidental Mutation 'R3439:Vpreb3'
ID 267321
Institutional Source Beutler Lab
Gene Symbol Vpreb3
Ensembl Gene ENSMUSG00000000903
Gene Name V-set pre-B cell surrogate light chain 3
Synonyms 8HS-20, Vpreb-3
MMRRC Submission 040657-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3439 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 75778891-75785491 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 75779056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121151] [ENSMUST00000219979]
AlphaFold D3Z6J4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059658
SMART Domains Protein: ENSMUSP00000055979
Gene: ENSMUSG00000050157

DomainStartEndE-ValueType
Pfam:Il2rg 2 89 6.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117331
Predicted Effect unknown
Transcript: ENSMUST00000121151
AA Change: A2V
SMART Domains Protein: ENSMUSP00000113205
Gene: ENSMUSG00000000903
AA Change: A2V

DomainStartEndE-ValueType
IGv 43 124 1.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219979
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of the mouse VpreB3 (8HS20) protein, is thought to be involved in B-cell maturation, and may play a role in assembly of the pre-B cell receptor (pre-BCR). While the role of this protein in B-cell development has not yet been elucidated, studies with the chicken ortholog of this protein have found that when overexpressed, this protein localizes to the endoplasmic reticulum. The mouse ortholog of this protein has been shown to associate with membrane mu heavy chains early in the course of pre-B cell receptor biosynthesis. Expression of this gene has been observed in some lymphomas. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 C A 15: 10,381,511 (GRCm39) P255Q probably benign Het
Cdcp3 T C 7: 130,790,508 (GRCm39) probably null Het
Dnah10 T C 5: 124,873,322 (GRCm39) Y2458H possibly damaging Het
Dnhd1 A G 7: 105,343,992 (GRCm39) T1779A probably damaging Het
Glb1l A T 1: 75,179,264 (GRCm39) C222S probably damaging Het
Gnb1l A G 16: 18,371,117 (GRCm39) T203A probably benign Het
Helq T C 5: 100,946,170 (GRCm39) E57G probably damaging Het
Kng2 T C 16: 22,830,821 (GRCm39) I163V probably benign Het
Larp7-ps A C 4: 92,079,919 (GRCm39) V23G possibly damaging Het
Lingo1 T C 9: 56,528,017 (GRCm39) T191A probably benign Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Med13 T C 11: 86,176,123 (GRCm39) D1624G probably damaging Het
Mthfsd A G 8: 121,825,860 (GRCm39) V218A possibly damaging Het
Naip1 A T 13: 100,559,727 (GRCm39) D1092E probably benign Het
Nom1 T C 5: 29,640,615 (GRCm39) S314P probably benign Het
Nwd2 G A 5: 63,961,895 (GRCm39) R493H probably benign Het
Or4f58 T C 2: 111,851,792 (GRCm39) M136V possibly damaging Het
Or5an11 A T 19: 12,245,759 (GRCm39) H55L possibly damaging Het
Palm C T 10: 79,652,618 (GRCm39) probably benign Het
Pitpnm1 A G 19: 4,162,752 (GRCm39) E1115G probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prrc2b T C 2: 32,096,359 (GRCm39) F577L probably benign Het
Rnpepl1 A T 1: 92,844,662 (GRCm39) T385S possibly damaging Het
Serpinb7 A T 1: 107,356,081 (GRCm39) I35F probably damaging Het
Srbd1 C T 17: 86,365,187 (GRCm39) S623N probably benign Het
Tchh A G 3: 93,354,700 (GRCm39) E1380G unknown Het
Tet2 G T 3: 133,172,592 (GRCm39) A1890D possibly damaging Het
Tfr2 G T 5: 137,572,913 (GRCm39) V215F probably benign Het
Vwde T A 6: 13,208,374 (GRCm39) L169F probably damaging Het
Other mutations in Vpreb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Vpreb3 APN 10 75,784,231 (GRCm39) missense probably benign
IGL02051:Vpreb3 APN 10 75,784,244 (GRCm39) critical splice donor site probably null
IGL03162:Vpreb3 APN 10 75,785,133 (GRCm39) missense probably damaging 1.00
R2319:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R2891:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R2892:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R2894:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R3438:Vpreb3 UTSW 10 75,779,056 (GRCm39) unclassified probably benign
R3508:Vpreb3 UTSW 10 75,785,037 (GRCm39) missense probably benign 0.26
R3725:Vpreb3 UTSW 10 75,779,125 (GRCm39) critical splice donor site probably null
R3726:Vpreb3 UTSW 10 75,779,125 (GRCm39) critical splice donor site probably null
R3771:Vpreb3 UTSW 10 75,775,800 (GRCm39) missense probably benign 0.00
R4975:Vpreb3 UTSW 10 75,775,636 (GRCm39) missense probably damaging 1.00
Z1177:Vpreb3 UTSW 10 75,785,027 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTCCTTGAACAGCC -3'
(R):5'- GCAAACCAAGTATGCAACTGG -3'

Sequencing Primer
(F):5'- TGAACAGCCCCCAGTTTG -3'
(R):5'- CTTTCCTATAAAGGGTGAGCACAC -3'
Posted On 2015-02-18