Incidental Mutation 'R3439:Palm'
ID267322
Institutional Source Beutler Lab
Gene Symbol Palm
Ensembl Gene ENSMUSG00000035863
Gene Nameparalemmin
Synonyms
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79793572-79820896 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 79816784 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046945] [ENSMUST00000105379] [ENSMUST00000169041] [ENSMUST00000218631] [ENSMUST00000218857] [ENSMUST00000220365]
Predicted Effect probably benign
Transcript: ENSMUST00000046945
SMART Domains Protein: ENSMUSP00000040596
Gene: ENSMUSG00000035863

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:Paralemmin 71 383 4.2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105379
SMART Domains Protein: ENSMUSP00000101018
Gene: ENSMUSG00000035863

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:Paralemmin 70 339 1.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169041
SMART Domains Protein: ENSMUSP00000130071
Gene: ENSMUSG00000035852

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 1.7e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218631
Predicted Effect probably benign
Transcript: ENSMUST00000218857
Predicted Effect probably benign
Transcript: ENSMUST00000220365
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paralemmin protein family. The product of this gene is a prenylated and palmitoylated phosphoprotein that associates with the cytoplasmic face of plasma membranes and is implicated in plasma membrane dynamics in neurons and other cell types. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Palm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Palm APN 10 79816787 splice site probably benign
IGL03080:Palm APN 10 79819117 missense probably damaging 1.00
IGL03143:Palm APN 10 79816783 splice site probably benign
R0681:Palm UTSW 10 79819493 missense probably benign 0.35
R1476:Palm UTSW 10 79815187 missense possibly damaging 0.50
R1534:Palm UTSW 10 79816903 missense probably damaging 1.00
R4327:Palm UTSW 10 79807686 missense probably benign 0.31
R4328:Palm UTSW 10 79807686 missense probably benign 0.31
R4329:Palm UTSW 10 79807686 missense probably benign 0.31
R6586:Palm UTSW 10 79809531 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCAGAGCTATGGAAGGATCTG -3'
(R):5'- TGAGTGACTAACCAGGCCAG -3'

Sequencing Primer
(F):5'- GCTATGGAAGGATCTGGAGTG -3'
(R):5'- TGACTAACCAGGCCAGGAGAAAG -3'
Posted On2015-02-18