Incidental Mutation 'R3439:Srbd1'
ID267331
Institutional Source Beutler Lab
Gene Symbol Srbd1
Ensembl Gene ENSMUSG00000024135
Gene NameS1 RNA binding domain 1
Synonyms
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85984665-86145175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86057759 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 623 (S623N)
Ref Sequence ENSEMBL: ENSMUSP00000092810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095187]
Predicted Effect probably benign
Transcript: ENSMUST00000095187
AA Change: S623N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: S623N

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Tex_N 213 403 2.8e-43 PFAM
YqgFc 532 631 4.1e-32 SMART
Pfam:HHH_7 668 764 1.6e-6 PFAM
Pfam:HHH_3 698 762 4.2e-25 PFAM
S1 903 978 7e-15 SMART
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Srbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Srbd1 APN 17 86115209 missense probably damaging 1.00
IGL00988:Srbd1 APN 17 86130270 missense probably damaging 0.96
IGL01111:Srbd1 APN 17 86098533 missense probably benign 0.15
IGL02186:Srbd1 APN 17 86109231 missense probably benign
IGL02233:Srbd1 APN 17 86098622 splice site probably null
IGL02307:Srbd1 APN 17 86126188 missense probably damaging 1.00
IGL02392:Srbd1 APN 17 85988373 missense probably benign 0.34
IGL02831:Srbd1 APN 17 86003871 missense probably damaging 1.00
IGL03299:Srbd1 APN 17 86120659 missense possibly damaging 0.95
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0464:Srbd1 UTSW 17 86120002 missense probably damaging 1.00
R0692:Srbd1 UTSW 17 86136460 missense probably benign 0.25
R0771:Srbd1 UTSW 17 86130254 missense probably benign 0.09
R1074:Srbd1 UTSW 17 86003952 missense probably damaging 1.00
R1173:Srbd1 UTSW 17 86098512 missense probably null 1.00
R1446:Srbd1 UTSW 17 86139152 missense probably benign 0.44
R1587:Srbd1 UTSW 17 85985437 missense probably damaging 1.00
R1780:Srbd1 UTSW 17 86057685 missense probably damaging 1.00
R1865:Srbd1 UTSW 17 86115304 splice site probably benign
R1933:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R1934:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R2002:Srbd1 UTSW 17 86142400 missense probably benign
R2228:Srbd1 UTSW 17 85985223 missense probably damaging 1.00
R3160:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3611:Srbd1 UTSW 17 86102927 missense probably benign 0.03
R4255:Srbd1 UTSW 17 86102922 missense possibly damaging 0.80
R4300:Srbd1 UTSW 17 85985204 missense probably damaging 0.98
R4319:Srbd1 UTSW 17 86051150 missense probably damaging 1.00
R4619:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4620:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4629:Srbd1 UTSW 17 86120672 missense probably damaging 0.99
R5379:Srbd1 UTSW 17 86001536 missense possibly damaging 0.88
R5469:Srbd1 UTSW 17 86119942 missense possibly damaging 0.77
R5587:Srbd1 UTSW 17 86127801 missense probably damaging 0.99
R5726:Srbd1 UTSW 17 86120729 missense possibly damaging 0.89
R6166:Srbd1 UTSW 17 86099268 missense probably damaging 1.00
R6237:Srbd1 UTSW 17 85985295 missense probably damaging 0.99
R6696:Srbd1 UTSW 17 86139191 missense possibly damaging 0.46
R6971:Srbd1 UTSW 17 86099290 missense possibly damaging 0.79
R6986:Srbd1 UTSW 17 85985222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCATGTGGCAAAGCTTTTACAC -3'
(R):5'- TGGATGTGAGCCTTTGCATC -3'

Sequencing Primer
(F):5'- GGCAAAGCTTTTACACTTTCTTGG -3'
(R):5'- GATGTGAGCCTTTGCATCTGCTATC -3'
Posted On2015-02-18