Mutagenetix > Incidental Mutation

Incidental Mutation 'R3440:Kif1a'

267335

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

N-3 kinesin, C630002N23Rik, Kns1, LOC381283, ATSV

MMRRC Submission

040658-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.847) question?

Stock #

R3440 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92943186-93029673 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92964575 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1334 (D1334N)

Ref Sequence

ENSEMBL: ENSMUSP00000140163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000086819
AA Change: D1241N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: D1241N

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112958
AA Change: D1232N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: D1232N

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171556
AA Change: D1232N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: D1232N

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171796
AA Change: D1232N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: D1232N

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188493

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190723
AA Change: D1334N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: D1334N

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Meta Mutation Damage Score

0.1750

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (29/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	C	A	2: 103,397,577 (GRCm39)	A169E	probably benign	Het
Adam3	T	C	8: 25,170,759 (GRCm39)		probably benign	Het
Agmo	C	T	12: 37,293,799 (GRCm39)	T74I	probably damaging	Het
Ano6	T	C	15: 95,865,602 (GRCm39)	V862A	probably damaging	Het
Bltp1	C	T	3: 37,096,061 (GRCm39)	Q4614*	probably null	Het
Cavin2	T	A	1: 51,340,565 (GRCm39)	V414E	probably damaging	Het
Clrn3	A	C	7: 135,115,854 (GRCm39)	Y165*	probably null	Het
Cp	A	T	3: 20,029,121 (GRCm39)	M533L	probably benign	Het
Dhrs3	T	A	4: 144,646,628 (GRCm39)	M226K	probably damaging	Het
Fignl2	A	G	15: 100,951,004 (GRCm39)	F426S	unknown	Het
Fpr1	C	T	17: 18,097,420 (GRCm39)	D190N	probably benign	Het
Grik3	C	A	4: 125,587,763 (GRCm39)	L628M	probably damaging	Het
Grik3	T	A	4: 125,587,764 (GRCm39)	L628Q	probably damaging	Het
Grin2c	T	A	11: 115,141,469 (GRCm39)	D883V	probably damaging	Het
Gtf3c6	T	A	10: 40,127,169 (GRCm39)	E123V	probably null	Het
H2-Eb1	A	G	17: 34,528,655 (GRCm39)	E62G	probably damaging	Het
Lef1	A	G	3: 130,978,407 (GRCm39)	D175G	probably damaging	Het
Myom1	A	G	17: 71,352,658 (GRCm39)		probably null	Het
Or6k2	A	T	1: 173,986,746 (GRCm39)	M136L	probably benign	Het
Pgr	A	T	9: 8,922,630 (GRCm39)	N600I	probably damaging	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Selp	T	C	1: 163,951,344 (GRCm39)	F26S	probably benign	Het
Tchh	A	T	3: 93,352,414 (GRCm39)	D618V	unknown	Het
Tenm4	A	T	7: 96,202,723 (GRCm39)	M88L	probably benign	Het
Zfat	A	T	15: 67,956,402 (GRCm39)	D1143E	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	92,982,656 (GRCm39)	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93,010,062 (GRCm39)	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	92,967,575 (GRCm39)	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	92,953,455 (GRCm39)	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	92,948,271 (GRCm39)	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	92,948,178 (GRCm39)	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	92,990,280 (GRCm39)	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	92,967,569 (GRCm39)	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	92,966,985 (GRCm39)	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	92,993,903 (GRCm39)	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	92,986,579 (GRCm39)	nonsense	probably null
IGL03354:Kif1a	APN	1	92,987,957 (GRCm39)	missense	probably damaging	1.00
asbestos	UTSW	1	92,950,227 (GRCm39)	missense	probably damaging	1.00
chrysolite	UTSW	1	93,002,670 (GRCm39)	splice site	probably benign
osmium	UTSW	1	92,986,532 (GRCm39)	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93,004,769 (GRCm39)	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93,004,790 (GRCm39)	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93,010,128 (GRCm39)	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	92,974,451 (GRCm39)	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	92,970,080 (GRCm39)	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	92,974,500 (GRCm39)	splice site	probably benign
R0243:Kif1a	UTSW	1	92,969,815 (GRCm39)	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	92,982,164 (GRCm39)	splice site	probably benign
R0335:Kif1a	UTSW	1	92,980,288 (GRCm39)	splice site	probably benign
R0380:Kif1a	UTSW	1	92,983,753 (GRCm39)	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	92,946,719 (GRCm39)	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	92,983,967 (GRCm39)	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	92,971,360 (GRCm39)	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	92,947,605 (GRCm39)	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	92,947,620 (GRCm39)	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	92,951,175 (GRCm39)	splice site	probably benign
R1132:Kif1a	UTSW	1	92,983,743 (GRCm39)	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	92,983,672 (GRCm39)	splice site	probably benign
R1466:Kif1a	UTSW	1	92,982,651 (GRCm39)	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	92,982,651 (GRCm39)	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93,002,670 (GRCm39)	splice site	probably benign
R1569:Kif1a	UTSW	1	92,986,532 (GRCm39)	splice site	probably benign
R1802:Kif1a	UTSW	1	92,993,871 (GRCm39)	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	92,946,753 (GRCm39)	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	92,946,753 (GRCm39)	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	92,988,517 (GRCm39)	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	92,982,051 (GRCm39)	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	92,996,199 (GRCm39)	splice site	probably benign
R2307:Kif1a	UTSW	1	93,006,491 (GRCm39)	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	92,974,464 (GRCm39)	missense	probably damaging	1.00
R3441:Kif1a	UTSW	1	92,964,575 (GRCm39)	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93,004,765 (GRCm39)	missense	probably null	1.00
R3957:Kif1a	UTSW	1	92,953,416 (GRCm39)	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	92,950,131 (GRCm39)	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93,004,014 (GRCm39)	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93,004,014 (GRCm39)	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	92,980,260 (GRCm39)	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	92,996,272 (GRCm39)	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93,004,769 (GRCm39)	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	92,952,368 (GRCm39)	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	92,970,381 (GRCm39)	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93,006,557 (GRCm39)	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	92,953,449 (GRCm39)	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	92,948,931 (GRCm39)	splice site	probably null
R4903:Kif1a	UTSW	1	92,949,456 (GRCm39)	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93,002,700 (GRCm39)	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93,002,700 (GRCm39)	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93,006,530 (GRCm39)	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	92,982,049 (GRCm39)	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93,003,876 (GRCm39)	splice site	probably null
R5073:Kif1a	UTSW	1	92,950,227 (GRCm39)	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	92,974,418 (GRCm39)	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	92,946,220 (GRCm39)	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	92,987,966 (GRCm39)	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	92,969,414 (GRCm39)	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	92,953,450 (GRCm39)	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	92,983,489 (GRCm39)	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	92,970,420 (GRCm39)	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	92,953,365 (GRCm39)	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	92,952,370 (GRCm39)	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	92,982,618 (GRCm39)	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	92,952,296 (GRCm39)	splice site	probably null
R6126:Kif1a	UTSW	1	92,947,621 (GRCm39)	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	92,964,623 (GRCm39)	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	92,947,705 (GRCm39)	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	92,982,663 (GRCm39)	nonsense	probably null
R6326:Kif1a	UTSW	1	93,004,048 (GRCm39)	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	92,949,035 (GRCm39)	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93,005,420 (GRCm39)	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	92,993,859 (GRCm39)	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	92,967,524 (GRCm39)	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	92,993,820 (GRCm39)	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	92,974,551 (GRCm39)	intron	probably benign
R7103:Kif1a	UTSW	1	93,005,507 (GRCm39)	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	92,969,305 (GRCm39)	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93,001,532 (GRCm39)	nonsense	probably null
R7424:Kif1a	UTSW	1	92,982,039 (GRCm39)	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	92,974,542 (GRCm39)	intron	probably benign
R7681:Kif1a	UTSW	1	92,982,666 (GRCm39)	missense	probably benign
R7976:Kif1a	UTSW	1	92,967,496 (GRCm39)	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	92,982,423 (GRCm39)	intron	probably benign
R8420:Kif1a	UTSW	1	92,950,141 (GRCm39)	missense	probably benign
R8994:Kif1a	UTSW	1	92,983,457 (GRCm39)	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	92,953,395 (GRCm39)	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	92,979,202 (GRCm39)	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93,005,501 (GRCm39)	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93,002,776 (GRCm39)	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93,000,029 (GRCm39)	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	92,949,019 (GRCm39)	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	92,953,416 (GRCm39)	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	92,983,445 (GRCm39)	missense	probably benign
R9625:Kif1a	UTSW	1	93,000,766 (GRCm39)	missense	probably benign	0.42
R9694:Kif1a	UTSW	1	92,950,173 (GRCm39)	missense	probably benign
Z1176:Kif1a	UTSW	1	92,950,213 (GRCm39)	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	92,949,038 (GRCm39)	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	92,983,419 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGAGAGACTCAGAGCCCATG -3'
(R):5'- ATGGCCCGTAGTCATGTAGG -3'

Sequencing Primer
(F):5'- TGGGCCACCACTCACTG -3'
(R):5'- CCGTAGTCATGTAGGGAATCCAC -3'

Posted On

2015-02-18