Incidental Mutation 'R3442:Dbt'
ID 267406
Institutional Source Beutler Lab
Gene Symbol Dbt
Ensembl Gene ENSMUSG00000000340
Gene Name dihydrolipoamide branched chain transacylase E2
Synonyms dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, D3Wsu60e, dihydrolipoyl transacylase, BCKAD E2
MMRRC Submission 040660-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3442 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 116306776-116343630 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116341840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 480 (D480E)
Ref Sequence ENSEMBL: ENSMUSP00000000349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000349]
AlphaFold P53395
Predicted Effect probably benign
Transcript: ENSMUST00000000349
AA Change: D480E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: D480E

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 65 138 2.8e-22 PFAM
Pfam:E3_binding 171 206 4.4e-18 PFAM
low complexity region 218 232 N/A INTRINSIC
Pfam:2-oxoacid_dh 248 479 8.5e-83 PFAM
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,246,583 (GRCm39) Y26* probably null Het
Adam30 T C 3: 98,069,886 (GRCm39) I573T probably benign Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Cav3 G A 6: 112,449,402 (GRCm39) C140Y possibly damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cfap91 T C 16: 38,154,168 (GRCm39) M126V probably benign Het
Dmbt1 G A 7: 130,707,979 (GRCm39) C1407Y probably damaging Het
Frem3 C T 8: 81,339,669 (GRCm39) P654L probably damaging Het
Glb1l2 C T 9: 26,692,038 (GRCm39) A74T probably damaging Het
Gpx1 C G 9: 108,216,549 (GRCm39) T13S probably benign Het
Grik3 C A 4: 125,587,763 (GRCm39) L628M probably damaging Het
Grik3 T A 4: 125,587,764 (GRCm39) L628Q probably damaging Het
Gsap A G 5: 21,483,125 (GRCm39) Y610C probably damaging Het
Gtf3c6 T A 10: 40,127,169 (GRCm39) E123V probably null Het
Htr3b T C 9: 48,856,815 (GRCm39) D221G probably benign Het
Msmb A G 14: 31,872,173 (GRCm39) N55D probably benign Het
Mx1 T A 16: 97,257,431 (GRCm39) I109F probably damaging Het
Mynn T C 3: 30,667,712 (GRCm39) F471L probably damaging Het
Or9i2 T C 19: 13,816,370 (GRCm39) T56A possibly damaging Het
Otof T C 5: 30,529,033 (GRCm39) R1792G probably damaging Het
Sil1 A T 18: 35,458,449 (GRCm39) L182H probably damaging Het
Sla C T 15: 66,655,509 (GRCm39) G210D probably benign Het
Slc26a7 C T 4: 14,565,511 (GRCm39) V191M probably benign Het
Trrap A G 5: 144,729,062 (GRCm39) M659V probably benign Het
Ubxn6 G T 17: 56,376,049 (GRCm39) Q371K probably benign Het
Zfat A T 15: 67,956,402 (GRCm39) D1143E probably benign Het
Zfat C T 15: 67,973,430 (GRCm39) A1122T probably damaging Het
Zfp950 A T 19: 61,107,170 (GRCm39) C149* probably null Het
Other mutations in Dbt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Dbt APN 3 116,332,930 (GRCm39) missense probably benign
IGL00660:Dbt APN 3 116,339,944 (GRCm39) missense probably damaging 1.00
IGL00839:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL00840:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL00841:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL00852:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL00861:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL00955:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL00956:Dbt APN 3 116,339,763 (GRCm39) missense probably benign 0.21
IGL01475:Dbt APN 3 116,313,908 (GRCm39) missense possibly damaging 0.92
IGL01521:Dbt APN 3 116,327,032 (GRCm39) missense probably benign 0.00
IGL01806:Dbt APN 3 116,326,954 (GRCm39) missense probably damaging 1.00
IGL03288:Dbt APN 3 116,341,847 (GRCm39) makesense probably null
R0025:Dbt UTSW 3 116,328,432 (GRCm39) missense probably benign 0.22
R0066:Dbt UTSW 3 116,337,478 (GRCm39) missense probably benign 0.00
R0066:Dbt UTSW 3 116,337,478 (GRCm39) missense probably benign 0.00
R0190:Dbt UTSW 3 116,332,736 (GRCm39) critical splice acceptor site probably null
R1650:Dbt UTSW 3 116,328,381 (GRCm39) splice site probably null
R1750:Dbt UTSW 3 116,339,943 (GRCm39) missense probably benign 0.18
R2130:Dbt UTSW 3 116,332,773 (GRCm39) missense probably damaging 1.00
R2131:Dbt UTSW 3 116,332,773 (GRCm39) missense probably damaging 1.00
R2133:Dbt UTSW 3 116,332,773 (GRCm39) missense probably damaging 1.00
R2897:Dbt UTSW 3 116,317,061 (GRCm39) missense probably damaging 1.00
R4241:Dbt UTSW 3 116,326,945 (GRCm39) missense probably damaging 1.00
R4681:Dbt UTSW 3 116,326,963 (GRCm39) missense probably damaging 1.00
R4724:Dbt UTSW 3 116,326,945 (GRCm39) missense probably damaging 1.00
R4736:Dbt UTSW 3 116,332,781 (GRCm39) missense probably damaging 0.99
R4737:Dbt UTSW 3 116,332,781 (GRCm39) missense probably damaging 0.99
R4738:Dbt UTSW 3 116,332,781 (GRCm39) missense probably damaging 0.99
R4740:Dbt UTSW 3 116,332,781 (GRCm39) missense probably damaging 0.99
R4809:Dbt UTSW 3 116,339,992 (GRCm39) missense probably damaging 1.00
R4823:Dbt UTSW 3 116,317,036 (GRCm39) missense probably damaging 1.00
R4861:Dbt UTSW 3 116,341,727 (GRCm39) missense probably benign 0.00
R4861:Dbt UTSW 3 116,341,727 (GRCm39) missense probably benign 0.00
R5148:Dbt UTSW 3 116,321,893 (GRCm39) intron probably benign
R5327:Dbt UTSW 3 116,322,220 (GRCm39) intron probably benign
R5700:Dbt UTSW 3 116,313,952 (GRCm39) missense probably damaging 0.97
R5931:Dbt UTSW 3 116,317,074 (GRCm39) missense possibly damaging 0.80
R6463:Dbt UTSW 3 116,333,409 (GRCm39) missense possibly damaging 0.51
R7841:Dbt UTSW 3 116,339,746 (GRCm39) missense possibly damaging 0.85
R8122:Dbt UTSW 3 116,313,891 (GRCm39) nonsense probably null
R8385:Dbt UTSW 3 116,317,039 (GRCm39) missense probably damaging 1.00
R8941:Dbt UTSW 3 116,339,698 (GRCm39) missense probably damaging 0.99
R9734:Dbt UTSW 3 116,339,704 (GRCm39) missense probably benign
RF008:Dbt UTSW 3 116,341,717 (GRCm39) nonsense probably null
RF016:Dbt UTSW 3 116,333,363 (GRCm39) missense probably damaging 1.00
Z1177:Dbt UTSW 3 116,339,740 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTCCTACCACTGTTGC -3'
(R):5'- GCAGAAAGCCCAATGTGTCAG -3'

Sequencing Primer
(F):5'- CTATGAGTGAGTGAAAGTTTACCC -3'
(R):5'- CCCAATGTGTCAGTGAGAAATACTG -3'
Posted On 2015-02-18