Incidental Mutation 'R3508:Inpp1'
ID267437
Institutional Source Beutler Lab
Gene Symbol Inpp1
Ensembl Gene ENSMUSG00000026102
Gene Nameinositol polyphosphate-1-phosphatase
Synonyms2300002C06Rik
MMRRC Submission 040664-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3508 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location52785427-52817688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52799391 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 33 (I33N)
Ref Sequence ENSEMBL: ENSMUSP00000135225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027271] [ENSMUST00000159725] [ENSMUST00000162576] [ENSMUST00000177279]
Predicted Effect probably damaging
Transcript: ENSMUST00000027271
AA Change: I33N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027271
Gene: ENSMUSG00000026102
AA Change: I33N

DomainStartEndE-ValueType
Pfam:Inositol_P 56 378 5.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159607
Predicted Effect probably damaging
Transcript: ENSMUST00000159725
AA Change: I33N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123977
Gene: ENSMUSG00000026102
AA Change: I33N

DomainStartEndE-ValueType
PDB:1INP|A 1 80 4e-36 PDB
SCOP:d1inp__ 1 80 8e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162351
Predicted Effect probably damaging
Transcript: ENSMUST00000162576
AA Change: I33N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124890
Gene: ENSMUSG00000026102
AA Change: I33N

DomainStartEndE-ValueType
PDB:1INP|A 1 90 8e-43 PDB
SCOP:d1inp__ 1 90 5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177279
AA Change: I33N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135225
Gene: ENSMUSG00000026102
AA Change: I33N

DomainStartEndE-ValueType
PDB:1INP|A 1 68 8e-27 PDB
SCOP:d1inp__ 1 68 1e-31 SMART
low complexity region 71 90 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme inositol polyphosphate-1-phosphatase, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 1 of the inositol ring from the polyphosphates inositol 1,4-bisphosphate and inositol 1,3,4-trisphophosphate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a targeted allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,505 Y500* probably null Het
Abca8a A T 11: 110,063,165 F816L probably benign Het
Adgrl3 C A 5: 81,724,256 N932K probably damaging Het
Apol8 T C 15: 77,749,443 E311G probably damaging Het
Atad2b G A 12: 4,950,595 probably null Het
Carmil1 A G 13: 24,019,676 probably benign Het
Cdc20b T C 13: 113,081,042 S332P possibly damaging Het
Cep162 A G 9: 87,231,977 probably null Het
Cfap54 T A 10: 92,885,424 S2482C unknown Het
Cnpy1 T C 5: 28,207,367 E107G probably damaging Het
Crtac1 C T 19: 42,304,741 V310I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Elmo1 T C 13: 20,605,232 I706T probably damaging Het
F12 T C 13: 55,421,059 T297A probably benign Het
Fanci A G 7: 79,433,472 I736V probably benign Het
Fbn1 T C 2: 125,306,327 N2667S probably benign Het
Flt4 T C 11: 49,634,114 S596P probably damaging Het
Fndc1 G A 17: 7,765,108 R1329* probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
H2-M10.1 T G 17: 36,325,614 R99S possibly damaging Het
Homer3 T A 8: 70,291,355 V243D probably benign Het
Hspa14 A G 2: 3,491,008 S437P probably damaging Het
Ipo5 T A 14: 120,939,544 Y714N probably damaging Het
Kif27 T C 13: 58,313,212 E898G possibly damaging Het
Klhdc7b T A 15: 89,386,892 M1K probably null Het
Krt83 A G 15: 101,488,158 Y241H probably benign Het
Mfsd4b1 A G 10: 40,002,719 I394T probably benign Het
Micall1 A G 15: 79,122,765 D264G probably damaging Het
Mms22l T G 4: 24,586,224 D905E probably benign Het
Musk A G 4: 58,327,347 D217G probably damaging Het
Napb T C 2: 148,698,960 T236A probably benign Het
Nbn T A 4: 15,962,387 D38E probably damaging Het
Ncaph T C 2: 127,127,193 N87D probably benign Het
Olfr1251 A G 2: 89,667,472 V138A probably benign Het
Pcdhb13 T A 18: 37,443,151 V194E probably damaging Het
Pck1 T C 2: 173,158,384 V536A possibly damaging Het
Pld5 C T 1: 175,994,037 G188S probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Pnkd A G 1: 74,350,634 T306A probably benign Het
Ppm1k T C 6: 57,514,990 E279G probably damaging Het
Ppm1l G T 3: 69,549,480 K243N possibly damaging Het
Ppp1r13b T C 12: 111,872,367 T26A probably damaging Het
Rtel1 T C 2: 181,322,409 V67A probably benign Het
Rxfp4 T C 3: 88,652,592 E184G probably damaging Het
Scp2d1 A G 2: 144,823,998 I86V probably benign Het
Sec16a G T 2: 26,425,850 P1718Q probably damaging Het
Sgcg T A 14: 61,221,746 T245S probably benign Het
Slc18a2 A G 19: 59,273,557 T215A probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sox17 G T 1: 4,492,155 P146Q probably damaging Het
Sybu T A 15: 44,673,082 E616V probably damaging Het
Tk2 C T 8: 104,231,193 V174I probably benign Het
Tmc5 G A 7: 118,645,395 V499I probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tonsl T C 15: 76,639,756 T15A probably benign Het
Ttll12 A G 15: 83,580,630 I448T probably damaging Het
Ttn A G 2: 76,753,757 S22336P probably damaging Het
Ubap1 C A 4: 41,379,163 H126N probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vmn2r84 T C 10: 130,390,908 N354D probably damaging Het
Vpreb3 A C 10: 75,949,203 H45P probably benign Het
Zc3h13 T A 14: 75,308,940 Y160* probably null Het
Other mutations in Inpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Inpp1 APN 1 52799327 missense probably damaging 1.00
R0344:Inpp1 UTSW 1 52799354 missense probably damaging 1.00
R1356:Inpp1 UTSW 1 52797056 missense possibly damaging 0.95
R1465:Inpp1 UTSW 1 52790094 missense probably benign
R1465:Inpp1 UTSW 1 52790094 missense probably benign
R1907:Inpp1 UTSW 1 52789670 makesense probably null
R1954:Inpp1 UTSW 1 52794629 missense probably damaging 1.00
R2033:Inpp1 UTSW 1 52790173 missense possibly damaging 0.71
R2104:Inpp1 UTSW 1 52799418 missense probably damaging 1.00
R2224:Inpp1 UTSW 1 52790131 missense probably benign 0.07
R4682:Inpp1 UTSW 1 52794601 missense probably benign 0.00
R5252:Inpp1 UTSW 1 52794547 missense probably benign 0.00
R5590:Inpp1 UTSW 1 52794661 missense probably damaging 0.96
R6354:Inpp1 UTSW 1 52797065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCAGTAAAAGGCCTGCTG -3'
(R):5'- AGAGACGCCCTGACATCATC -3'

Sequencing Primer
(F):5'- GTCAGTAAAAGGCCTGCTGTTTATTC -3'
(R):5'- TGACATCATCCCTGAACTGC -3'
Posted On2015-02-18