Incidental Mutation 'R3508:Sec16a'
ID267442
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 040664-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3508 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26425850 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1718 (P1718Q)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: P1718Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: P1718Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114082
AA Change: P1718Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: P1718Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156442
AA Change: P267Q
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924
AA Change: P267Q

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,505 Y500* probably null Het
Abca8a A T 11: 110,063,165 F816L probably benign Het
Adgrl3 C A 5: 81,724,256 N932K probably damaging Het
Apol8 T C 15: 77,749,443 E311G probably damaging Het
Atad2b G A 12: 4,950,595 probably null Het
Carmil1 A G 13: 24,019,676 probably benign Het
Cdc20b T C 13: 113,081,042 S332P possibly damaging Het
Cep162 A G 9: 87,231,977 probably null Het
Cfap54 T A 10: 92,885,424 S2482C unknown Het
Cnpy1 T C 5: 28,207,367 E107G probably damaging Het
Crtac1 C T 19: 42,304,741 V310I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Elmo1 T C 13: 20,605,232 I706T probably damaging Het
F12 T C 13: 55,421,059 T297A probably benign Het
Fanci A G 7: 79,433,472 I736V probably benign Het
Fbn1 T C 2: 125,306,327 N2667S probably benign Het
Flt4 T C 11: 49,634,114 S596P probably damaging Het
Fndc1 G A 17: 7,765,108 R1329* probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
H2-M10.1 T G 17: 36,325,614 R99S possibly damaging Het
Homer3 T A 8: 70,291,355 V243D probably benign Het
Hspa14 A G 2: 3,491,008 S437P probably damaging Het
Inpp1 A T 1: 52,799,391 I33N probably damaging Het
Ipo5 T A 14: 120,939,544 Y714N probably damaging Het
Kif27 T C 13: 58,313,212 E898G possibly damaging Het
Klhdc7b T A 15: 89,386,892 M1K probably null Het
Krt83 A G 15: 101,488,158 Y241H probably benign Het
Mfsd4b1 A G 10: 40,002,719 I394T probably benign Het
Micall1 A G 15: 79,122,765 D264G probably damaging Het
Mms22l T G 4: 24,586,224 D905E probably benign Het
Musk A G 4: 58,327,347 D217G probably damaging Het
Napb T C 2: 148,698,960 T236A probably benign Het
Nbn T A 4: 15,962,387 D38E probably damaging Het
Ncaph T C 2: 127,127,193 N87D probably benign Het
Olfr1251 A G 2: 89,667,472 V138A probably benign Het
Pcdhb13 T A 18: 37,443,151 V194E probably damaging Het
Pck1 T C 2: 173,158,384 V536A possibly damaging Het
Pld5 C T 1: 175,994,037 G188S probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Pnkd A G 1: 74,350,634 T306A probably benign Het
Ppm1k T C 6: 57,514,990 E279G probably damaging Het
Ppm1l G T 3: 69,549,480 K243N possibly damaging Het
Ppp1r13b T C 12: 111,872,367 T26A probably damaging Het
Rtel1 T C 2: 181,322,409 V67A probably benign Het
Rxfp4 T C 3: 88,652,592 E184G probably damaging Het
Scp2d1 A G 2: 144,823,998 I86V probably benign Het
Sgcg T A 14: 61,221,746 T245S probably benign Het
Slc18a2 A G 19: 59,273,557 T215A probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sox17 G T 1: 4,492,155 P146Q probably damaging Het
Sybu T A 15: 44,673,082 E616V probably damaging Het
Tk2 C T 8: 104,231,193 V174I probably benign Het
Tmc5 G A 7: 118,645,395 V499I probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tonsl T C 15: 76,639,756 T15A probably benign Het
Ttll12 A G 15: 83,580,630 I448T probably damaging Het
Ttn A G 2: 76,753,757 S22336P probably damaging Het
Ubap1 C A 4: 41,379,163 H126N probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vmn2r84 T C 10: 130,390,908 N354D probably damaging Het
Vpreb3 A C 10: 75,949,203 H45P probably benign Het
Zc3h13 T A 14: 75,308,940 Y160* probably null Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCTCTTATGGTTCTGGCACAG -3'
(R):5'- CATCCACGGTGAGTATGCAG -3'

Sequencing Primer
(F):5'- TGGCACAGTTGTTCACACAG -3'
(R):5'- ACAGTCCAGTGTGATTTGTGCATAC -3'
Posted On2015-02-18