Incidental Mutation 'R3522:Ptpn13'
ID267533
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 103589854 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957]
Predicted Effect probably benign
Transcript: ENSMUST00000048957
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGATGTTGCCTTCTTTGTAGG -3'
(R):5'- CACAGTTAGACCCACACTGG -3'

Sequencing Primer
(F):5'- ATGCTATTAGTCGGCTGATCATGACC -3'
(R):5'- GTTAGACCCACACTGGAACAC -3'
Posted On2015-02-18