Incidental Mutation 'R3522:Trpv6'
ID267537
Institutional Source Beutler Lab
Gene Symbol Trpv6
Ensembl Gene ENSMUSG00000029868
Gene Nametransient receptor potential cation channel, subfamily V, member 6
SynonymsCAT, Ecac2, CaT1, Cac
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41620624-41636405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41627405 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 139 (M139K)
Ref Sequence ENSEMBL: ENSMUSP00000143854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000201471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031902
AA Change: M139K

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868
AA Change: M139K

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194405
Predicted Effect probably damaging
Transcript: ENSMUST00000201471
AA Change: M139K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868
AA Change: M139K

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired sperm motility and decreased fertilization by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Trpv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Trpv6 APN 6 41626867 splice site probably benign
IGL02033:Trpv6 APN 6 41627617 splice site probably benign
IGL02439:Trpv6 APN 6 41625487 missense probably damaging 1.00
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0974:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R1385:Trpv6 UTSW 6 41621129 missense probably benign 0.32
R1696:Trpv6 UTSW 6 41621768 missense possibly damaging 0.95
R2095:Trpv6 UTSW 6 41621756 missense probably damaging 0.99
R2287:Trpv6 UTSW 6 41626111 missense probably damaging 1.00
R2298:Trpv6 UTSW 6 41636076 missense possibly damaging 0.62
R2519:Trpv6 UTSW 6 41624616 nonsense probably null
R4172:Trpv6 UTSW 6 41625498 missense probably damaging 1.00
R4397:Trpv6 UTSW 6 41625238 missense possibly damaging 0.82
R4568:Trpv6 UTSW 6 41626569 missense probably damaging 1.00
R4571:Trpv6 UTSW 6 41621744 missense probably damaging 1.00
R5547:Trpv6 UTSW 6 41636154 missense possibly damaging 0.68
R6344:Trpv6 UTSW 6 41625422 splice site probably null
R6989:Trpv6 UTSW 6 41625456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTCTGGACCAGATGTAATG -3'
(R):5'- TGCAGCAGAATTCTAGCTTTGG -3'

Sequencing Primer
(F):5'- CCTCTGGACCAGATGTAATGAGTTG -3'
(R):5'- GGTTAGTCCCCCATCCTACAGAC -3'
Posted On2015-02-18