Incidental Mutation 'R3522:Ros1'
ID267556
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 52090995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1705 (Y1705*)
Ref Sequence ENSEMBL: ENSMUSP00000151615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably null
Transcript: ENSMUST00000020045
AA Change: Y1726*
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: Y1726*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117992
AA Change: Y1705*
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: Y1705*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177378
AA Change: Y1705*
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: Y1705*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218452
AA Change: Y1705*
Predicted Effect probably null
Transcript: ENSMUST00000219173
AA Change: Y1705*
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Meta Mutation Damage Score 0.636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 unclassified probably null
R3424:Ros1 UTSW 10 52128416 unclassified probably null
R3425:Ros1 UTSW 10 52128416 unclassified probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTTTTGGGATAGCATTGGAAATG -3'
(R):5'- TCATTTCAGTTAAAAGGGGCCATTC -3'

Sequencing Primer
(F):5'- TGGGATAGCATTGGAAATGTAATTG -3'
(R):5'- GGGGCCATTCATCTAATTATAACCTG -3'
Posted On2015-02-18