Incidental Mutation 'R3522:Olfr768'
ID267560
Institutional Source Beutler Lab
Gene Symbol Olfr768
Ensembl Gene ENSMUSG00000050198
Gene Nameolfactory receptor 768
SynonymsGA_x6K02T2PULF-10779441-10778503, MOR114-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129090222-129099375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129093842 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 44 (I44T)
Ref Sequence ENSEMBL: ENSMUSP00000089619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063031]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063031
AA Change: I44T

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089619
Gene: ENSMUSG00000050198
AA Change: I44T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216681
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Olfr768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Olfr768 APN 10 129093396 missense probably benign 0.08
IGL01947:Olfr768 APN 10 129093878 missense possibly damaging 0.52
IGL03026:Olfr768 APN 10 129093188 missense possibly damaging 0.60
R1353:Olfr768 UTSW 10 129093864 missense probably benign 0.14
R1426:Olfr768 UTSW 10 129093690 missense probably damaging 1.00
R1766:Olfr768 UTSW 10 129093747 missense probably benign 0.24
R2356:Olfr768 UTSW 10 129093892 missense probably benign 0.40
R3751:Olfr768 UTSW 10 129093306 missense probably damaging 1.00
R3779:Olfr768 UTSW 10 129093296 missense possibly damaging 0.94
R4582:Olfr768 UTSW 10 129093158 missense possibly damaging 0.93
R4772:Olfr768 UTSW 10 129093668 missense possibly damaging 0.92
R4792:Olfr768 UTSW 10 129093620 missense probably damaging 1.00
R5749:Olfr768 UTSW 10 129093097 missense probably damaging 0.98
R6571:Olfr768 UTSW 10 129093121 missense probably damaging 0.98
R6619:Olfr768 UTSW 10 129093454 missense possibly damaging 0.95
X0024:Olfr768 UTSW 10 129093115 missense possibly damaging 0.95
X0024:Olfr768 UTSW 10 129093347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATAGGACATGGCAGTCAG -3'
(R):5'- ATCCCTCATGCTGACAATCC -3'

Sequencing Primer
(F):5'- ACTCAGTCACACCCAGGAC -3'
(R):5'- ATGCTGACAATCCTTATCCTCAATC -3'
Posted On2015-02-18