Mutagenetix > Incidental Mutations

Incidental Mutation 'R3522:Nup155'

267570

Institutional Source

Beutler Lab

Gene Symbol

Nup155

Ensembl Gene

ENSMUSG00000022142

Gene Name

nucleoporin 155

Synonyms

D930027M19Rik

Accession Numbers

Genbank: NM_133227

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3522 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8109273-8161247 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 8156678 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]

Predicted Effect

probably benign
Transcript: ENSMUST00000163765

SMART Domains

Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
Pfam:Nucleoporin_N	77	510	3.5e-105	PFAM
low complexity region	600	619	N/A	INTRINSIC
Pfam:Nucleoporin_C	678	1221	3.6e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230925

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,549,626		probably null	Het
Ankrd35	A	G	3: 96,685,062	E888G	probably damaging	Het
Arhgef10	T	C	8: 14,954,918	F150S	probably damaging	Het
Atp10d	G	T	5: 72,239,157	R235L	probably benign	Het
Cacna1b	A	G	2: 24,763,043	V2A	possibly damaging	Het
Cand1	A	T	10: 119,239,197	L15Q	probably benign	Het
Cavin3	C	A	7: 105,481,143	G154V	probably benign	Het
Ccdc73	A	T	2: 104,991,485	D593V	probably damaging	Het
Cdk5rap2	T	C	4: 70,250,410	K161E	probably damaging	Het
Chil4	A	T	3: 106,203,740	N279K	probably benign	Het
Chst13	T	G	6: 90,318,263	D56A	probably damaging	Het
Cnn1	C	A	9: 22,099,368	H5N	probably benign	Het
Cpsf4l	T	A	11: 113,702,493	K88N	probably damaging	Het
Ctnnbl1	G	T	2: 157,871,193		probably null	Het
Dnah7a	A	C	1: 53,618,116	F834V	probably damaging	Het
Fbxo41	A	G	6: 85,484,181	S182P	probably benign	Het
Fkbp5	T	C	17: 28,415,996	T180A	probably benign	Het
Flg2	T	A	3: 93,220,027	I2082N	unknown	Het
Gm4968	A	G	6: 127,233,762		noncoding transcript	Het
Gpc5	T	A	14: 116,524,335	H612Q	probably benign	Het
Gsg1	A	T	6: 135,241,253	V212D	probably damaging	Het
Hipk1	A	G	3: 103,744,114	V1111A	probably damaging	Het
Hormad1	A	T	3: 95,576,285	Q136L	probably benign	Het
Ifi35	T	A	11: 101,457,685	S147R	probably benign	Het
Iqgap3	C	T	3: 88,090,782	A282V	probably null	Het
Jmy	T	C	13: 93,454,050	D515G	probably damaging	Het
Kctd10	G	A	5: 114,374,923	R64C	probably damaging	Het
Kidins220	T	C	12: 24,990,758	V121A	probably damaging	Het
Lcn3	G	A	2: 25,766,121	V63M	possibly damaging	Het
Lmx1b	T	A	2: 33,639,531	Y72F	probably benign	Het
Lrp1	T	C	10: 127,553,555	D3164G	probably damaging	Het
Mdh1b	C	T	1: 63,719,768	V222M	probably damaging	Het
Mst1	T	C	9: 108,081,503		probably benign	Het
Myo7b	C	A	18: 32,010,079	V189F	probably damaging	Het
Ndc1	T	C	4: 107,393,158	S533P	probably damaging	Het
Ndrg3	T	C	2: 156,944,027	D164G	probably damaging	Het
Nol11	C	T	11: 107,173,628	C500Y	possibly damaging	Het
Nsd3	A	G	8: 25,706,614	N1208D	probably benign	Het
Olfr768	A	G	10: 129,093,842	I44T	possibly damaging	Het
Olfr911-ps1	A	G	9: 38,523,785	T18A	probably damaging	Het
Olfr921	A	T	9: 38,775,720	D155V	possibly damaging	Het
Olfr988	A	T	2: 85,353,003	C308S	probably benign	Het
Phf3	A	G	1: 30,805,603	L1425P	probably damaging	Het
Pla2r1	A	G	2: 60,448,906	Y777H	probably damaging	Het
Pld1	A	G	3: 28,031,247	E184G	probably damaging	Het
Plxna1	T	C	6: 89,337,353		probably null	Het
Ptgfrn	T	C	3: 101,043,402	E865G	probably damaging	Het
Ptpn13	G	T	5: 103,589,854		probably benign	Het
Pygb	G	T	2: 150,828,553	V763F	probably benign	Het
Ros1	A	C	10: 52,090,995	Y1705*	probably null	Het
Sec61a2	A	G	2: 5,893,216	F5L	probably benign	Het
Skint5	A	G	4: 113,756,905		probably null	Het
Sntg2	A	G	12: 30,312,567	V60A	probably damaging	Het
Sppl2a	A	G	2: 126,920,322	C280R	possibly damaging	Het
Srrm4	A	C	5: 116,446,544	M1R	probably null	Het
Sult1c1	T	C	17: 53,972,015	E91G	probably damaging	Het
Themis2	C	G	4: 132,785,595	R440P	probably damaging	Het
Tmem229a	A	G	6: 24,955,059	L232P	probably benign	Het
Trappc1	T	C	11: 69,324,422	F43L	probably damaging	Het
Trappc11	A	T	8: 47,498,673	Y982N	possibly damaging	Het
Trpv6	A	T	6: 41,627,405	M139K	probably damaging	Het
Txnrd3	A	G	6: 89,663,075		probably null	Het
Vmn1r184	T	A	7: 26,267,583	Y251*	probably null	Het
Vmn1r216	A	G	13: 23,099,374	N76D	possibly damaging	Het
Vmn1r71	C	A	7: 10,747,865	V233F	probably benign	Het
Vps13a	A	C	19: 16,766,493		probably benign	Het
Vwa5b2	A	G	16: 20,601,608	S756G	probably damaging	Het
Wdr36	T	A	18: 32,861,485		probably null	Het
Wdr86	A	G	5: 24,718,307	V129A	probably benign	Het
Zfyve9	A	G	4: 108,719,743	L47S	probably benign	Het

Other mutations in Nup155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nup155	APN	15	8121455	splice site	probably benign
IGL00426:Nup155	APN	15	8156794	makesense	probably null
IGL00765:Nup155	APN	15	8153228	missense	probably benign	0.16
IGL00936:Nup155	APN	15	8128405	splice site	probably benign
IGL01124:Nup155	APN	15	8153679	missense	probably damaging	0.97
IGL01739:Nup155	APN	15	8135788	missense	probably benign	0.01
IGL02013:Nup155	APN	15	8113648	missense	possibly damaging	0.61
IGL02066:Nup155	APN	15	8157766	unclassified	probably benign
IGL02231:Nup155	APN	15	8144064	missense	probably damaging	1.00
IGL02246:Nup155	APN	15	8143002	missense	probably benign
IGL02289:Nup155	APN	15	8131493	missense	probably damaging	1.00
IGL02608:Nup155	APN	15	8109471	missense	probably benign
IGL02749:Nup155	APN	15	8134076	missense	probably damaging	1.00
IGL02813:Nup155	APN	15	8130121	splice site	probably benign
IGL03102:Nup155	APN	15	8147284	missense	probably benign	0.00
H8930:Nup155	UTSW	15	8157658	missense	possibly damaging	0.50
IGL02835:Nup155	UTSW	15	8143130	missense	probably damaging	1.00
R0314:Nup155	UTSW	15	8147252	missense	probably benign	0.00
R0365:Nup155	UTSW	15	8131543	missense	probably damaging	1.00
R0586:Nup155	UTSW	15	8130232	missense	probably benign	0.39
R0764:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R0839:Nup155	UTSW	15	8145587	missense	possibly damaging	0.48
R0844:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1066:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1067:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1085:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1137:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1162:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1166:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1202:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1203:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1219:Nup155	UTSW	15	8117338	missense	possibly damaging	0.80
R1385:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1421:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1448:Nup155	UTSW	15	8112406	missense	probably benign	0.44
R1611:Nup155	UTSW	15	8130160	missense	probably damaging	1.00
R1836:Nup155	UTSW	15	8154980	missense	possibly damaging	0.79
R1863:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1866:Nup155	UTSW	15	8115526	missense	probably damaging	1.00
R1894:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1976:Nup155	UTSW	15	8135827	missense	probably benign	0.01
R2024:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2026:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2027:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2077:Nup155	UTSW	15	8143026	missense	probably damaging	1.00
R2111:Nup155	UTSW	15	8121467	missense	probably benign	0.45
R2921:Nup155	UTSW	15	8153641	missense	probably damaging	1.00
R2936:Nup155	UTSW	15	8143049	missense	possibly damaging	0.89
R3108:Nup155	UTSW	15	8117306	missense	probably null	1.00
R3161:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R4423:Nup155	UTSW	15	8121464	missense	probably damaging	0.99
R4451:Nup155	UTSW	15	8150882	missense	probably benign	0.02
R4498:Nup155	UTSW	15	8153673	missense	possibly damaging	0.88
R4780:Nup155	UTSW	15	8157703	missense	probably benign	0.00
R4822:Nup155	UTSW	15	8128526	missense	possibly damaging	0.49
R5013:Nup155	UTSW	15	8124238	missense	probably benign	0.00
R5064:Nup155	UTSW	15	8135870	missense	probably damaging	1.00
R5172:Nup155	UTSW	15	8109542	missense	probably benign	0.06
R5406:Nup155	UTSW	15	8153638	critical splice acceptor site	probably null
R5551:Nup155	UTSW	15	8148333	missense	probably benign	0.09
R5588:Nup155	UTSW	15	8119253	critical splice donor site	probably null
R5977:Nup155	UTSW	15	8130237	critical splice donor site	probably null
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6085:Nup155	UTSW	15	8148358	missense	probably damaging	0.98
R6188:Nup155	UTSW	15	8109575	missense	probably damaging	1.00
R6232:Nup155	UTSW	15	8109479	missense	probably benign	0.02
R6257:Nup155	UTSW	15	8150798	nonsense	probably null
R6262:Nup155	UTSW	15	8156741	missense	probably benign	0.03
R6267:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6296:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6299:Nup155	UTSW	15	8128438	missense	possibly damaging	0.88
R6303:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6304:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6763:Nup155	UTSW	15	8135895	nonsense	probably null
R6958:Nup155	UTSW	15	8147154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAGTACATTCAATATATCTGGGAGG -3'
(R):5'- AACCCTTCTCCCAGGTACTTAGTAG -3'

Sequencing Primer
(F):5'- CTGATCTAGAAGCTGAGGTGATCTC -3'
(R):5'- CTAGGCTAGGATTCTCAACATA -3'

Posted On

2015-02-18