Incidental Mutation 'R3522:Vwa5b2'
ID267572
Institutional Source Beutler Lab
Gene Symbol Vwa5b2
Ensembl Gene ENSMUSG00000046613
Gene Namevon Willebrand factor A domain containing 5B2
SynonymsEG328644
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20589471-20605377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20601608 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 756 (S756G)
Ref Sequence ENSEMBL: ENSMUSP00000123727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000096197] [ENSMUST00000100074] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000149236] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
Predicted Effect probably benign
Transcript: ENSMUST00000045918
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046188
Predicted Effect probably damaging
Transcript: ENSMUST00000096197
AA Change: S756G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613
AA Change: S756G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100074
SMART Domains Protein: ENSMUSP00000097652
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 1.9e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 572 586 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117019
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127454
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000149236
SMART Domains Protein: ENSMUSP00000124117
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.9e-32 PFAM
Blast:VWA 352 408 2e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159780
AA Change: S756G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613
AA Change: S756G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000231386
Predicted Effect probably benign
Transcript: ENSMUST00000231387
Predicted Effect probably benign
Transcript: ENSMUST00000231471
Predicted Effect probably benign
Transcript: ENSMUST00000231531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231608
Predicted Effect probably benign
Transcript: ENSMUST00000231749
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000232319
Predicted Effect probably benign
Transcript: ENSMUST00000232451
Predicted Effect probably benign
Transcript: ENSMUST00000232458
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Vwa5b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Vwa5b2 APN 16 20604270 missense probably benign
IGL01543:Vwa5b2 APN 16 20595716 missense probably benign 0.02
IGL01719:Vwa5b2 APN 16 20597433 critical splice donor site probably null
IGL02006:Vwa5b2 APN 16 20597093 missense probably damaging 0.97
IGL02150:Vwa5b2 APN 16 20604826 missense probably benign
IGL02301:Vwa5b2 APN 16 20604790 missense probably damaging 1.00
IGL02373:Vwa5b2 APN 16 20604844 missense probably damaging 0.99
IGL02413:Vwa5b2 APN 16 20598101 missense probably damaging 1.00
IGL02664:Vwa5b2 APN 16 20595313 unclassified probably benign
R1171:Vwa5b2 UTSW 16 20604984 missense probably benign
R1405:Vwa5b2 UTSW 16 20604316 missense probably benign 0.00
R1405:Vwa5b2 UTSW 16 20604316 missense probably benign 0.00
R1464:Vwa5b2 UTSW 16 20596269 missense probably benign 0.08
R1464:Vwa5b2 UTSW 16 20596269 missense probably benign 0.08
R1730:Vwa5b2 UTSW 16 20600925 missense probably damaging 1.00
R1901:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1902:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1903:Vwa5b2 UTSW 16 20604832 missense possibly damaging 0.77
R1959:Vwa5b2 UTSW 16 20602191 critical splice donor site probably null
R1961:Vwa5b2 UTSW 16 20602191 critical splice donor site probably null
R3687:Vwa5b2 UTSW 16 20591558 unclassified probably benign
R3746:Vwa5b2 UTSW 16 20598326 intron probably benign
R3747:Vwa5b2 UTSW 16 20598326 intron probably benign
R3749:Vwa5b2 UTSW 16 20598326 intron probably benign
R3952:Vwa5b2 UTSW 16 20598361 makesense probably null
R4641:Vwa5b2 UTSW 16 20604643 missense probably damaging 1.00
R4646:Vwa5b2 UTSW 16 20596329 missense probably damaging 1.00
R4772:Vwa5b2 UTSW 16 20600803 splice site probably null
R5032:Vwa5b2 UTSW 16 20600709 missense probably damaging 1.00
R5286:Vwa5b2 UTSW 16 20596308 missense probably damaging 1.00
R5569:Vwa5b2 UTSW 16 20595339 missense probably damaging 1.00
R5585:Vwa5b2 UTSW 16 20594678 nonsense probably null
R5640:Vwa5b2 UTSW 16 20597542 missense probably damaging 1.00
R6330:Vwa5b2 UTSW 16 20601977 missense probably damaging 1.00
R6459:Vwa5b2 UTSW 16 20594679 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGAATGACTGTCAGACGGAG -3'
(R):5'- TTTGGTGTCAGAAAACCAGCG -3'

Sequencing Primer
(F):5'- CAGAATGACTGTCAGACGGAGTTAGG -3'
(R):5'- GTCCCATCCAACCCTTACCTGAATC -3'
Posted On2015-02-18