Incidental Mutation 'R3522:Fkbp5'
ID267573
Institutional Source Beutler Lab
Gene Symbol Fkbp5
Ensembl Gene ENSMUSG00000024222
Gene NameFK506 binding protein 5
SynonymsFKBP51, D17Ertd592e, Dit1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28399095-28517524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28415996 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 180 (T180A)
Ref Sequence ENSEMBL: ENSMUSP00000136245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079413] [ENSMUST00000114792] [ENSMUST00000153744] [ENSMUST00000177939]
Predicted Effect probably benign
Transcript: ENSMUST00000079413
AA Change: T180A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000078382
Gene: ENSMUSG00000024222
AA Change: T180A

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 7.1e-31 PFAM
Pfam:FKBP_C 158 248 2.1e-14 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114792
AA Change: T180A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110440
Gene: ENSMUSG00000024222
AA Change: T180A

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 7.1e-31 PFAM
Pfam:FKBP_C 158 248 2.1e-14 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143685
Predicted Effect probably benign
Transcript: ENSMUST00000153744
AA Change: T180A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116466
Gene: ENSMUSG00000024222
AA Change: T180A

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 8e-32 PFAM
internal_repeat_1 138 182 6.75e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000177939
AA Change: T180A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136245
Gene: ENSMUSG00000024222
AA Change: T180A

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 8.8e-32 PFAM
Pfam:FKBP_C 158 248 1.8e-15 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It is thought to mediate calcineurin inhibition. It also interacts functionally with mature hetero-oligomeric progesterone receptor complexes along with the 90 kDa heat shock protein and P23 protein. This gene has been found to have multiple polyadenylation sites. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele are normal and fertile. Mice homozygous for another knock-out allele exhibit decreased depression-related behavior and increased anxiety-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Fkbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Fkbp5 APN 17 28401046 utr 3 prime probably benign
IGL03104:Fkbp5 APN 17 28415972 missense probably damaging 1.00
R0242:Fkbp5 UTSW 17 28428452 missense probably benign 0.01
R0242:Fkbp5 UTSW 17 28428452 missense probably benign 0.01
R0531:Fkbp5 UTSW 17 28438029 missense probably benign 0.00
R1557:Fkbp5 UTSW 17 28402755 missense probably damaging 0.96
R1853:Fkbp5 UTSW 17 28429307 missense possibly damaging 0.82
R2102:Fkbp5 UTSW 17 28406188 missense possibly damaging 0.81
R2194:Fkbp5 UTSW 17 28438027 missense probably benign 0.32
R4959:Fkbp5 UTSW 17 28428369 missense probably damaging 1.00
R4973:Fkbp5 UTSW 17 28428369 missense probably damaging 1.00
R5164:Fkbp5 UTSW 17 28437990 critical splice donor site probably null
R6053:Fkbp5 UTSW 17 28428466 missense probably benign 0.00
R6443:Fkbp5 UTSW 17 28429279 missense probably damaging 1.00
R6989:Fkbp5 UTSW 17 28415945 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGCAATGGCTTCCCTGC -3'
(R):5'- GACTAGGTGGGCAAAGCTTC -3'

Sequencing Primer
(F):5'- CAAGCAGTCCTTGGTCTTCAGG -3'
(R):5'- GCTTCCAGAAGACACTGTGTG -3'
Posted On2015-02-18