Incidental Mutation 'R3195:Skint9'
ID267589
Institutional Source Beutler Lab
Gene Symbol Skint9
Ensembl Gene ENSMUSG00000049972
Gene Nameselection and upkeep of intraepithelial T cells 9
Synonyms
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112385969-112433985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112390951 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 199 (I199L)
Ref Sequence ENSEMBL: ENSMUSP00000052670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058605]
Predicted Effect probably benign
Transcript: ENSMUST00000058605
AA Change: I199L

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052670
Gene: ENSMUSG00000049972
AA Change: I199L

DomainStartEndE-ValueType
PDB:4F8T|A 26 125 1e-9 PDB
Blast:IG_like 32 119 8e-12 BLAST
SCOP:d1eula_ 154 245 5e-3 SMART
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Skint9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02399:Skint9 APN 4 112389250 missense possibly damaging 0.88
IGL02417:Skint9 APN 4 112414138 splice site probably benign
IGL03111:Skint9 APN 4 112391724 missense probably benign 0.01
R0390:Skint9 UTSW 4 112389179 missense probably benign 0.21
R0400:Skint9 UTSW 4 112414001 missense probably damaging 1.00
R1606:Skint9 UTSW 4 112389201 missense probably benign 0.02
R1757:Skint9 UTSW 4 112413962 missense probably benign 0.03
R2431:Skint9 UTSW 4 112389267 missense probably damaging 1.00
R3196:Skint9 UTSW 4 112390951 missense probably benign 0.37
R4329:Skint9 UTSW 4 112391865 missense probably damaging 0.98
R4855:Skint9 UTSW 4 112391011 missense probably benign
R4986:Skint9 UTSW 4 112391713 missense probably benign 0.00
R5093:Skint9 UTSW 4 112389250 missense probably benign 0.01
R5844:Skint9 UTSW 4 112413883 missense probably benign 0.01
R5897:Skint9 UTSW 4 112413916 missense possibly damaging 0.95
R7123:Skint9 UTSW 4 112390977 nonsense probably null
R7406:Skint9 UTSW 4 112389231 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGCACTTGAATCCACTAGG -3'
(R):5'- GTTGTATCTTACTAACGCTAACCC -3'

Sequencing Primer
(F):5'- CCACTAGGATGTTACTGAAACCATG -3'
(R):5'- GCATCAAGACCTTCAAGAC -3'
Posted On2015-02-18