Incidental Mutation 'R3195:Iqub'
ID267595
Institutional Source Beutler Lab
Gene Symbol Iqub
Ensembl Gene ENSMUSG00000046192
Gene NameIQ motif and ubiquitin domain containing
Synonyms4932408B21Rik, Trs4
MMRRC Submission 040616-MU
Accession Numbers

Genbank: NM_172535; MGI: 3041159

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24444865-24515067 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 24462037 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052277]
Predicted Effect probably benign
Transcript: ENSMUST00000052277
SMART Domains Protein: ENSMUSP00000051177
Gene: ENSMUSG00000046192

DomainStartEndE-ValueType
PDB:2DAF|A 119 216 1e-38 PDB
Blast:UBQ 129 199 3e-26 BLAST
low complexity region 218 229 N/A INTRINSIC
low complexity region 289 306 N/A INTRINSIC
IQ 333 355 1.74e-1 SMART
low complexity region 357 383 N/A INTRINSIC
low complexity region 735 742 N/A INTRINSIC
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Iqub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Iqub APN 6 24501006 splice site probably benign
IGL01447:Iqub APN 6 24505628 missense probably benign 0.01
IGL01621:Iqub APN 6 24446212 missense probably benign 0.45
IGL01702:Iqub APN 6 24500313 missense probably benign 0.13
IGL01917:Iqub APN 6 24479319 missense probably damaging 0.97
IGL02411:Iqub APN 6 24449811 missense probably damaging 0.98
IGL02580:Iqub APN 6 24501399 missense probably benign 0.06
IGL02704:Iqub APN 6 24505910 splice site probably benign
IGL02901:Iqub APN 6 24454195 missense probably damaging 1.00
D4043:Iqub UTSW 6 24505751 missense possibly damaging 0.81
R0304:Iqub UTSW 6 24454291 missense probably damaging 0.99
R0391:Iqub UTSW 6 24446155 missense probably benign 0.00
R0453:Iqub UTSW 6 24450830 missense probably damaging 1.00
R0464:Iqub UTSW 6 24479263 nonsense probably null
R0465:Iqub UTSW 6 24503784 missense probably damaging 1.00
R0479:Iqub UTSW 6 24505810 missense probably benign 0.28
R0606:Iqub UTSW 6 24501261 splice site probably benign
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1238:Iqub UTSW 6 24505885 missense probably benign 0.03
R1452:Iqub UTSW 6 24491559 missense probably benign 0.13
R1927:Iqub UTSW 6 24491671 missense probably benign 0.11
R4438:Iqub UTSW 6 24505868 missense probably benign 0.01
R4577:Iqub UTSW 6 24501291 missense probably damaging 0.99
R4671:Iqub UTSW 6 24479184 missense probably benign 0.00
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4906:Iqub UTSW 6 24501369 missense probably damaging 0.99
R5605:Iqub UTSW 6 24505621 missense probably benign
R5772:Iqub UTSW 6 24454251 missense possibly damaging 0.64
R5801:Iqub UTSW 6 24449769 missense probably benign 0.11
R5853:Iqub UTSW 6 24491602 missense probably benign 0.00
R6423:Iqub UTSW 6 24491529 missense probably damaging 0.98
R6475:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6476:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6477:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6701:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6702:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6703:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6860:Iqub UTSW 6 24505738 missense possibly damaging 0.81
R7331:Iqub UTSW 6 24500394 missense possibly damaging 0.73
R7530:Iqub UTSW 6 24450623 missense probably benign 0.00
X0025:Iqub UTSW 6 24500384 missense probably damaging 0.96
Z1088:Iqub UTSW 6 24500243 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATACCTTCACAGTGTGTTTAAGCG -3'
(R):5'- TGCAGACCACCAGTTAGAACAG -3'

Sequencing Primer
(F):5'- CACAGTGTGTTTAAGCGTCAGGAG -3'
(R):5'- CACCAGTTAGAACAGAATCATTGGTG -3'
Posted On2015-02-18