Incidental Mutation 'R3195:Sh3rf1'
ID267601
Institutional Source Beutler Lab
Gene Symbol Sh3rf1
Ensembl Gene ENSMUSG00000031642
Gene NameSH3 domain containing ring finger 1
SynonymsSh3md2, Posh, 2200003J05Rik
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61223872-61396071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61226287 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 121 (P121L)
Ref Sequence ENSEMBL: ENSMUSP00000148118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]
Predicted Effect probably benign
Transcript: ENSMUST00000034060
AA Change: P121L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642
AA Change: P121L

DomainStartEndE-ValueType
RING 12 52 5.3e-9 SMART
low complexity region 83 90 N/A INTRINSIC
SH3 137 192 1.67e-18 SMART
SH3 199 258 4.84e-15 SMART
low complexity region 366 376 N/A INTRINSIC
low complexity region 397 405 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
SH3 454 511 7.92e-20 SMART
low complexity region 558 569 N/A INTRINSIC
low complexity region 638 651 N/A INTRINSIC
low complexity region 700 734 N/A INTRINSIC
SH3 835 891 1.47e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209611
AA Change: P121L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Sh3rf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Sh3rf1 APN 8 61329336 missense probably damaging 1.00
IGL01071:Sh3rf1 APN 8 61225959 missense probably damaging 1.00
IGL01485:Sh3rf1 APN 8 61329331 missense possibly damaging 0.79
IGL01587:Sh3rf1 APN 8 61226058 missense probably damaging 0.99
IGL02412:Sh3rf1 APN 8 61372689 missense probably benign 0.35
IGL02649:Sh3rf1 APN 8 61363191 missense probably damaging 1.00
limpid UTSW 8 61329258 missense probably damaging 1.00
IGL02835:Sh3rf1 UTSW 8 61226047 missense probably damaging 1.00
R0009:Sh3rf1 UTSW 8 61226293 missense probably damaging 0.97
R0016:Sh3rf1 UTSW 8 61374138 missense probably benign 0.18
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0278:Sh3rf1 UTSW 8 61374018 missense probably damaging 1.00
R0395:Sh3rf1 UTSW 8 61393662 splice site probably benign
R0733:Sh3rf1 UTSW 8 61372560 missense probably benign 0.00
R0790:Sh3rf1 UTSW 8 61329258 missense probably damaging 1.00
R1028:Sh3rf1 UTSW 8 61393787 missense possibly damaging 0.94
R1569:Sh3rf1 UTSW 8 61384862 missense probably damaging 1.00
R1654:Sh3rf1 UTSW 8 61361745 missense possibly damaging 0.92
R1799:Sh3rf1 UTSW 8 61372627 missense probably damaging 0.99
R1960:Sh3rf1 UTSW 8 61384863 missense probably damaging 1.00
R2181:Sh3rf1 UTSW 8 61363238 missense probably damaging 0.98
R2184:Sh3rf1 UTSW 8 61372654 missense probably damaging 0.99
R2330:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2331:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2332:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2967:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2994:Sh3rf1 UTSW 8 61372575 missense probably benign 0.10
R3159:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3196:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3724:Sh3rf1 UTSW 8 61372722 missense probably benign
R4692:Sh3rf1 UTSW 8 61353854 splice site probably null
R4712:Sh3rf1 UTSW 8 61361759 missense probably benign 0.00
R5214:Sh3rf1 UTSW 8 61372731 missense probably damaging 0.98
R5409:Sh3rf1 UTSW 8 61374245 missense probably benign 0.01
R5590:Sh3rf1 UTSW 8 61361732 missense probably benign 0.11
R5651:Sh3rf1 UTSW 8 61363167 missense probably damaging 1.00
R6976:Sh3rf1 UTSW 8 61361732 nonsense probably null
R7126:Sh3rf1 UTSW 8 61349424 missense probably benign 0.01
R7154:Sh3rf1 UTSW 8 61372714 missense possibly damaging 0.89
X0066:Sh3rf1 UTSW 8 61226197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGCCGGACTCTTGTTGG -3'
(R):5'- TCGGATCCAGTCTTATTTCAAGAG -3'

Sequencing Primer
(F):5'- GTCGACGAGCTCCCCAGTAAC -3'
(R):5'- AGAAAATAAGGTCCTAAGGTTGAATC -3'
Posted On2015-02-18