Incidental Mutation 'R3195:Mmp7'
ID267605
Institutional Source Beutler Lab
Gene Symbol Mmp7
Ensembl Gene ENSMUSG00000018623
Gene Namematrix metallopeptidase 7
SynonymsMAT, matrilysin
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7692090-7699585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7692218 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 31 (S31R)
Ref Sequence ENSEMBL: ENSMUSP00000018767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018767]
Predicted Effect probably benign
Transcript: ENSMUST00000018767
AA Change: S31R

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018767
Gene: ENSMUSG00000018623
AA Change: S31R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PG_binding_1 31 85 3e-11 PFAM
ZnMc 103 263 5.78e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216642
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein are deficient in functional cryptdins. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to induced colitis and corneal wound neovascularization, decreased sensitivity to myocardial infarction and pancreatic duct ligation, impaired tracheal wound healing, and altered tumor susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Mmp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Mmp7 APN 9 7699334 splice site probably benign
IGL01522:Mmp7 APN 9 7692228 missense probably damaging 1.00
R1740:Mmp7 UTSW 9 7695277 missense possibly damaging 0.92
R3118:Mmp7 UTSW 9 7697692 missense probably benign
R3196:Mmp7 UTSW 9 7692218 missense probably benign 0.03
R4595:Mmp7 UTSW 9 7697666 missense probably damaging 1.00
R5941:Mmp7 UTSW 9 7697645 missense probably damaging 1.00
R6193:Mmp7 UTSW 9 7695518 missense probably damaging 1.00
R6564:Mmp7 UTSW 9 7695184 missense probably benign 0.02
R6995:Mmp7 UTSW 9 7695488 missense probably damaging 0.98
R7146:Mmp7 UTSW 9 7697586 critical splice acceptor site probably null
R7398:Mmp7 UTSW 9 7697593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCACATTCAGGGCTGAGAAG -3'
(R):5'- AGGAGCTGGCATTCAACGAG -3'

Sequencing Primer
(F):5'- GAGAAGCCATATAAATTTCTCCAGC -3'
(R):5'- AAGCTTGGATGGCTACTCAC -3'
Posted On2015-02-18