Incidental Mutation 'R3195:Olfr395'
ID267608
Institutional Source Beutler Lab
Gene Symbol Olfr395
Ensembl Gene ENSMUSG00000062186
Gene Nameolfactory receptor 395
SynonymsGA_x6K02T2P1NL-4062605-4061667, MOR135-10
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73903318-73909299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73906658 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 278 (Y278C)
Ref Sequence ENSEMBL: ENSMUSP00000149064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072991] [ENSMUST00000215690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072991
AA Change: Y278C

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072756
Gene: ENSMUSG00000062186
AA Change: Y278C

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Pfam:7tm_4 31 309 6.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.8e-8 PFAM
Pfam:7tm_1 41 290 3.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215690
AA Change: Y278C

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Olfr395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr395 APN 11 73907313 missense probably damaging 1.00
IGL01618:Olfr395 APN 11 73907477 missense probably damaging 1.00
IGL01995:Olfr395 APN 11 73907435 missense possibly damaging 0.52
IGL02494:Olfr395 APN 11 73906724 missense possibly damaging 0.55
IGL02995:Olfr395 APN 11 73907219 missense possibly damaging 0.90
IGL03256:Olfr395 APN 11 73906696 missense probably benign 0.07
R0018:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R0701:Olfr395 UTSW 11 73906829 missense probably damaging 1.00
R0839:Olfr395 UTSW 11 73907312 missense probably damaging 0.99
R1222:Olfr395 UTSW 11 73907414 missense probably damaging 1.00
R1737:Olfr395 UTSW 11 73907085 missense possibly damaging 0.69
R1819:Olfr395 UTSW 11 73906679 missense probably benign 0.02
R2994:Olfr395 UTSW 11 73906715 missense probably damaging 1.00
R4622:Olfr395 UTSW 11 73906911 missense possibly damaging 0.55
R4753:Olfr395 UTSW 11 73906851 missense probably damaging 1.00
R5137:Olfr395 UTSW 11 73906626 missense probably damaging 1.00
R5448:Olfr395 UTSW 11 73906611 missense probably damaging 1.00
R5604:Olfr395 UTSW 11 73907027 missense probably benign 0.02
R5748:Olfr395 UTSW 11 73906895 missense probably damaging 0.98
R5899:Olfr395 UTSW 11 73906929 missense probably damaging 1.00
R6156:Olfr395 UTSW 11 73906621 nonsense probably null
R6388:Olfr395 UTSW 11 73907292 missense probably damaging 1.00
R6572:Olfr395 UTSW 11 73906803 missense possibly damaging 0.91
R7241:Olfr395 UTSW 11 73907232 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCTTGTAAGTACTATGATGAGGGG -3'
(R):5'- TGTCCTGCTCAGACACTTATG -3'

Sequencing Primer
(F):5'- AGTACTATGATGAGGGGAAATATCTG -3'
(R):5'- GTCCTGCTCAGACACTTATGTTAATG -3'
Posted On2015-02-18