Incidental Mutation 'R3195:9130401M01Rik'
ID267614
Institutional Source Beutler Lab
Gene Symbol 9130401M01Rik
Ensembl Gene ENSMUSG00000101892
Gene NameRIKEN cDNA 9130401M01 gene
Synonyms
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58022259-58034325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58028736 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 158 (N158K)
Ref Sequence ENSEMBL: ENSMUSP00000134752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100655] [ENSMUST00000176935] [ENSMUST00000177176] [ENSMUST00000185553]
Predicted Effect probably benign
Transcript: ENSMUST00000100655
AA Change: N222K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098220
Gene: ENSMUSG00000101892
AA Change: N222K

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
SCOP:d1elwa_ 49 174 2e-7 SMART
low complexity region 207 220 N/A INTRINSIC
low complexity region 241 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176935
AA Change: N158K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134752
Gene: ENSMUSG00000022362
AA Change: N158K

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177176
Predicted Effect probably benign
Transcript: ENSMUST00000185553
SMART Domains Protein: ENSMUSP00000140805
Gene: ENSMUSG00000101892

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187062
Predicted Effect probably benign
Transcript: ENSMUST00000189159
Meta Mutation Damage Score 0.0432 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in 9130401M01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0316:9130401M01Rik UTSW 15 58025369 missense probably damaging 0.96
R0318:9130401M01Rik UTSW 15 58028974 missense probably damaging 0.96
R0322:9130401M01Rik UTSW 15 58025372 missense possibly damaging 0.90
R0365:9130401M01Rik UTSW 15 58028692 missense probably benign 0.00
R1019:9130401M01Rik UTSW 15 58022427 missense possibly damaging 0.47
R1432:9130401M01Rik UTSW 15 58028860 missense probably damaging 1.00
R3196:9130401M01Rik UTSW 15 58028736 missense probably benign 0.31
R6439:9130401M01Rik UTSW 15 58032048 missense probably null 0.92
R6953:9130401M01Rik UTSW 15 58028827 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACGTACAGGATTCCTCCATC -3'
(R):5'- TGCCTGCACAAGCTGATTG -3'

Sequencing Primer
(F):5'- GTACAGGATTCCTCCATCCCTAC -3'
(R):5'- GCTGATTGCTTTGCACCCG -3'
Posted On2015-02-18